\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001512331:

Variant ID: vg1001512331 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 1512331
Reference Allele: CAlternative Allele: T,CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGACACCTTATTCCGGCGACTTCAAGACGGCGACGAGCTTGGAGAATCCATGGTGTAACGTGGTTAAAGGACGATTGGACCGGGGTGGTACATTAAAC[C/T,CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA]
AAGTTTACGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTAAGTGACACCACCCCCACAAGTTTAAGGACTGGCTATGTACACTCTTTTTTTTAAAA

Reverse complement sequence

TTTTAAAAAAAAGAGTGTACATAGCCAGTCCTTAAACTTGTGGGGGTGGTGTCACTTAGGTCCATGAACTTAAAAATTGCACATTTAGATCCGTAAACTT[G/A,TGTTTAATGTACCAGGTCCATGAACTTAAAAATTGCACATTTAGATCCG]
GTTTAATGTACCACCCCGGTCCAATCGTCCTTTAACCACGTTACACCATGGATTCTCCAAGCTCGTCGCCGTCTTGAAGTCGCCGGAATAAGGTGTCATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 14.70% 0.55% 29.60% CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA: 0.02%
All Indica  2759 57.20% 1.80% 0.54% 40.41% CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA: 0.04%
All Japonica  1512 58.60% 36.00% 0.13% 5.22% NA
Aus  269 1.10% 30.90% 2.60% 65.43% NA
Indica I  595 57.60% 1.50% 0.34% 40.50% NA
Indica II  465 68.40% 1.10% 0.86% 29.68% NA
Indica III  913 49.80% 2.60% 0.44% 47.10% NA
Indica Intermediate  786 58.90% 1.40% 0.64% 38.93% CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA: 0.13%
Temperate Japonica  767 31.80% 67.10% 0.13% 0.91% NA
Tropical Japonica  504 85.10% 1.60% 0.20% 13.10% NA
Japonica Intermediate  241 88.40% 9.10% 0.00% 2.49% NA
VI/Aromatic  96 85.40% 3.10% 1.04% 10.42% NA
Intermediate  90 63.30% 14.40% 1.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001512331 C -> CGGATCTAAATGTGCAATTTTTAAGTTCAT GGACCTGGTACATTAAACA LOC_Os10g03510.1 upstream_gene_variant ; 4085.0bp to feature; MODIFIER silent_mutation Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N
vg1001512331 C -> CGGATCTAAATGTGCAATTTTTAAGTTCAT GGACCTGGTACATTAAACA LOC_Os10g03500.1 downstream_gene_variant ; 2481.0bp to feature; MODIFIER silent_mutation Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N
vg1001512331 C -> CGGATCTAAATGTGCAATTTTTAAGTTCAT GGACCTGGTACATTAAACA LOC_Os10g03490-LOC_Os10g03500 intergenic_region ; MODIFIER silent_mutation Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N
vg1001512331 C -> T LOC_Os10g03510.1 upstream_gene_variant ; 4086.0bp to feature; MODIFIER silent_mutation Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N
vg1001512331 C -> T LOC_Os10g03500.1 downstream_gene_variant ; 2482.0bp to feature; MODIFIER silent_mutation Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N
vg1001512331 C -> T LOC_Os10g03490-LOC_Os10g03500 intergenic_region ; MODIFIER silent_mutation Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N
vg1001512331 C -> DEL N N silent_mutation Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001512331 NA 9.39E-08 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 1.03E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 2.46E-07 NA mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 1.30E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 3.43E-10 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 1.46E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 1.08E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 3.60E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 5.93E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 6.04E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 1.27E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 5.66E-12 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 7.92E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 5.37E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 2.07E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 9.32E-09 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 3.30E-07 9.40E-17 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 1.60E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331 NA 2.23E-10 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251