Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001512331:

Variant ID: vg1001512331 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 1512331
Reference Allele: C	Alternative Allele: T,CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGACACCTTATTCCGGCGACTTCAAGACGGCGACGAGCTTGGAGAATCCATGGTGTAACGTGGTTAAAGGACGATTGGACCGGGGTGGTACATTAAAC[C/T,CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA]
AAGTTTACGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTAAGTGACACCACCCCCACAAGTTTAAGGACTGGCTATGTACACTCTTTTTTTTAAAA

Reverse complement sequence

TTTTAAAAAAAAGAGTGTACATAGCCAGTCCTTAAACTTGTGGGGGTGGTGTCACTTAGGTCCATGAACTTAAAAATTGCACATTTAGATCCGTAAACTT[G/A,TGTTTAATGTACCAGGTCCATGAACTTAAAAATTGCACATTTAGATCCG]
GTTTAATGTACCACCCCGGTCCAATCGTCCTTTAACCACGTTACACCATGGATTCTCCAAGCTCGTCGCCGTCTTGAAGTCGCCGGAATAAGGTGTCATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	14.70%	0.55%	29.60%	CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA: 0.02%
All Indica	2759	57.20%	1.80%	0.54%	40.41%	CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA: 0.04%
All Japonica	1512	58.60%	36.00%	0.13%	5.22%	NA
Aus	269	1.10%	30.90%	2.60%	65.43%	NA
Indica I	595	57.60%	1.50%	0.34%	40.50%	NA
Indica II	465	68.40%	1.10%	0.86%	29.68%	NA
Indica III	913	49.80%	2.60%	0.44%	47.10%	NA
Indica Intermediate	786	58.90%	1.40%	0.64%	38.93%	CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA: 0.13%
Temperate Japonica	767	31.80%	67.10%	0.13%	0.91%	NA
Tropical Japonica	504	85.10%	1.60%	0.20%	13.10%	NA
Japonica Intermediate	241	88.40%	9.10%	0.00%	2.49%	NA
VI/Aromatic	96	85.40%	3.10%	1.04%	10.42%	NA
Intermediate	90	63.30%	14.40%	1.11%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001512331	C -> CGGATCTAAATGTGCAATTTTTAAGTTCAT GGACCTGGTACATTAAACA	LOC_Os10g03510.1	upstream_gene_variant ; 4085.0bp to feature; MODIFIER	silent_mutation	Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52	N	N	N	N
vg1001512331	C -> CGGATCTAAATGTGCAATTTTTAAGTTCAT GGACCTGGTACATTAAACA	LOC_Os10g03500.1	downstream_gene_variant ; 2481.0bp to feature; MODIFIER	silent_mutation	Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52	N	N	N	N
vg1001512331	C -> CGGATCTAAATGTGCAATTTTTAAGTTCAT GGACCTGGTACATTAAACA	LOC_Os10g03490-LOC_Os10g03500	intergenic_region ; MODIFIER	silent_mutation	Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52	N	N	N	N
vg1001512331	C -> T	LOC_Os10g03510.1	upstream_gene_variant ; 4086.0bp to feature; MODIFIER	silent_mutation	Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52	N	N	N	N
vg1001512331	C -> T	LOC_Os10g03500.1	downstream_gene_variant ; 2482.0bp to feature; MODIFIER	silent_mutation	Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52	N	N	N	N
vg1001512331	C -> T	LOC_Os10g03490-LOC_Os10g03500	intergenic_region ; MODIFIER	silent_mutation	Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52	N	N	N	N
vg1001512331	C -> DEL	N	N	silent_mutation	Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001512331	NA	9.39E-08	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	1.03E-07	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	2.46E-07	NA	mr1300	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	1.30E-08	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	3.43E-10	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	1.46E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	1.08E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	3.60E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	5.93E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	6.04E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	1.27E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	5.66E-12	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	7.92E-07	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	5.37E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	2.07E-07	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	9.32E-09	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	3.30E-07	9.40E-17	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	1.60E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001512331	NA	2.23E-10	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251