\
| Variant ID: vg1001512331 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 1512331 |
| Reference Allele: C | Alternative Allele: T,CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATGACACCTTATTCCGGCGACTTCAAGACGGCGACGAGCTTGGAGAATCCATGGTGTAACGTGGTTAAAGGACGATTGGACCGGGGTGGTACATTAAAC[C/T,CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA]
AAGTTTACGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTAAGTGACACCACCCCCACAAGTTTAAGGACTGGCTATGTACACTCTTTTTTTTAAAA
TTTTAAAAAAAAGAGTGTACATAGCCAGTCCTTAAACTTGTGGGGGTGGTGTCACTTAGGTCCATGAACTTAAAAATTGCACATTTAGATCCGTAAACTT[G/A,TGTTTAATGTACCAGGTCCATGAACTTAAAAATTGCACATTTAGATCCG]
GTTTAATGTACCACCCCGGTCCAATCGTCCTTTAACCACGTTACACCATGGATTCTCCAAGCTCGTCGCCGTCTTGAAGTCGCCGGAATAAGGTGTCATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 14.70% | 0.55% | 29.60% | CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA: 0.02% |
| All Indica | 2759 | 57.20% | 1.80% | 0.54% | 40.41% | CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA: 0.04% |
| All Japonica | 1512 | 58.60% | 36.00% | 0.13% | 5.22% | NA |
| Aus | 269 | 1.10% | 30.90% | 2.60% | 65.43% | NA |
| Indica I | 595 | 57.60% | 1.50% | 0.34% | 40.50% | NA |
| Indica II | 465 | 68.40% | 1.10% | 0.86% | 29.68% | NA |
| Indica III | 913 | 49.80% | 2.60% | 0.44% | 47.10% | NA |
| Indica Intermediate | 786 | 58.90% | 1.40% | 0.64% | 38.93% | CGGATCTAAATGTGCAATTTTTAAGTTCATGGACCTGGTACATTAAACA: 0.13% |
| Temperate Japonica | 767 | 31.80% | 67.10% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 85.10% | 1.60% | 0.20% | 13.10% | NA |
| Japonica Intermediate | 241 | 88.40% | 9.10% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 85.40% | 3.10% | 1.04% | 10.42% | NA |
| Intermediate | 90 | 63.30% | 14.40% | 1.11% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001512331 | C -> CGGATCTAAATGTGCAATTTTTAAGTTCAT GGACCTGGTACATTAAACA | LOC_Os10g03510.1 | upstream_gene_variant ; 4085.0bp to feature; MODIFIER | silent_mutation | Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 | N | N | N | N |
| vg1001512331 | C -> CGGATCTAAATGTGCAATTTTTAAGTTCAT GGACCTGGTACATTAAACA | LOC_Os10g03500.1 | downstream_gene_variant ; 2481.0bp to feature; MODIFIER | silent_mutation | Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 | N | N | N | N |
| vg1001512331 | C -> CGGATCTAAATGTGCAATTTTTAAGTTCAT GGACCTGGTACATTAAACA | LOC_Os10g03490-LOC_Os10g03500 | intergenic_region ; MODIFIER | silent_mutation | Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 | N | N | N | N |
| vg1001512331 | C -> T | LOC_Os10g03510.1 | upstream_gene_variant ; 4086.0bp to feature; MODIFIER | silent_mutation | Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 | N | N | N | N |
| vg1001512331 | C -> T | LOC_Os10g03500.1 | downstream_gene_variant ; 2482.0bp to feature; MODIFIER | silent_mutation | Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 | N | N | N | N |
| vg1001512331 | C -> T | LOC_Os10g03490-LOC_Os10g03500 | intergenic_region ; MODIFIER | silent_mutation | Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 | N | N | N | N |
| vg1001512331 | C -> DEL | N | N | silent_mutation | Average:21.002; most accessible tissue: Zhenshan97 young leaf, score: 40.52 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001512331 | NA | 9.39E-08 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 1.03E-07 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | 2.46E-07 | NA | mr1300 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 1.30E-08 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 3.43E-10 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 1.46E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 1.08E-07 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 3.60E-06 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 5.93E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 6.04E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | 1.27E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 5.66E-12 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 7.92E-07 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 5.37E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 2.07E-07 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | 9.32E-09 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | 3.30E-07 | 9.40E-17 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 1.60E-10 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001512331 | NA | 2.23E-10 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |