\
| Variant ID: vg1001508358 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1508358 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCCCATCCATGACATTTGGTAATACTGCCAGTTGGGCGATTTCATTTGATGTGATCTAAAATGTCATTCATTTGATCTGGAAAGTAGACTCCATGAAGC[T/C]
GTGAGGGTTCATTCCATCCTGAATCATCTCATCAGTTGGGTGATTTACTGTGATCATTTGTGCAACTATAATTTAGTAATTGTATACATCACCCTTAGTT
AACTAAGGGTGATGTATACAATTACTAAATTATAGTTGCACAAATGATCACAGTAAATCACCCAACTGATGAGATGATTCAGGATGGAATGAACCCTCAC[A/G]
GCTTCATGGAGTCTACTTTCCAGATCAAATGAATGACATTTTAGATCACATCAAATGAAATCGCCCAACTGGCAGTATTACCAAATGTCATGGATGGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.70% | 8.30% | 1.99% | 30.09% | NA |
| All Indica | 2759 | 58.20% | 0.30% | 0.47% | 40.99% | NA |
| All Japonica | 1512 | 64.80% | 24.70% | 5.16% | 5.29% | NA |
| Aus | 269 | 32.00% | 0.00% | 0.74% | 67.29% | NA |
| Indica I | 595 | 57.60% | 0.70% | 0.67% | 41.01% | NA |
| Indica II | 465 | 68.80% | 0.60% | 0.43% | 30.11% | NA |
| Indica III | 913 | 51.70% | 0.10% | 0.33% | 47.86% | NA |
| Indica Intermediate | 786 | 59.90% | 0.10% | 0.51% | 39.44% | NA |
| Temperate Japonica | 767 | 42.60% | 47.10% | 9.26% | 1.04% | NA |
| Tropical Japonica | 504 | 86.10% | 0.60% | 0.20% | 13.10% | NA |
| Japonica Intermediate | 241 | 90.90% | 4.10% | 2.49% | 2.49% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 70.00% | 7.80% | 1.11% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001508358 | T -> C | LOC_Os10g03490.1 | upstream_gene_variant ; 3690.0bp to feature; MODIFIER | silent_mutation | Average:19.927; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg1001508358 | T -> C | LOC_Os10g03490-LOC_Os10g03500 | intergenic_region ; MODIFIER | silent_mutation | Average:19.927; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg1001508358 | T -> DEL | N | N | silent_mutation | Average:19.927; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001508358 | NA | 1.72E-06 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | 8.94E-06 | 8.93E-06 | mr1261 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 3.77E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 1.81E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 3.22E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 1.43E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | 8.30E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 1.65E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | 9.70E-07 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 3.22E-10 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | 1.02E-07 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 6.96E-08 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | 7.90E-08 | NA | mr1617_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 1.90E-09 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 1.69E-14 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001508358 | NA | 7.87E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |