\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001508358:

Variant ID: vg1001508358 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1508358
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCCATCCATGACATTTGGTAATACTGCCAGTTGGGCGATTTCATTTGATGTGATCTAAAATGTCATTCATTTGATCTGGAAAGTAGACTCCATGAAGC[T/C]
GTGAGGGTTCATTCCATCCTGAATCATCTCATCAGTTGGGTGATTTACTGTGATCATTTGTGCAACTATAATTTAGTAATTGTATACATCACCCTTAGTT

Reverse complement sequence

AACTAAGGGTGATGTATACAATTACTAAATTATAGTTGCACAAATGATCACAGTAAATCACCCAACTGATGAGATGATTCAGGATGGAATGAACCCTCAC[A/G]
GCTTCATGGAGTCTACTTTCCAGATCAAATGAATGACATTTTAGATCACATCAAATGAAATCGCCCAACTGGCAGTATTACCAAATGTCATGGATGGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 8.30% 1.99% 30.09% NA
All Indica  2759 58.20% 0.30% 0.47% 40.99% NA
All Japonica  1512 64.80% 24.70% 5.16% 5.29% NA
Aus  269 32.00% 0.00% 0.74% 67.29% NA
Indica I  595 57.60% 0.70% 0.67% 41.01% NA
Indica II  465 68.80% 0.60% 0.43% 30.11% NA
Indica III  913 51.70% 0.10% 0.33% 47.86% NA
Indica Intermediate  786 59.90% 0.10% 0.51% 39.44% NA
Temperate Japonica  767 42.60% 47.10% 9.26% 1.04% NA
Tropical Japonica  504 86.10% 0.60% 0.20% 13.10% NA
Japonica Intermediate  241 90.90% 4.10% 2.49% 2.49% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 70.00% 7.80% 1.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001508358 T -> C LOC_Os10g03490.1 upstream_gene_variant ; 3690.0bp to feature; MODIFIER silent_mutation Average:19.927; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg1001508358 T -> C LOC_Os10g03490-LOC_Os10g03500 intergenic_region ; MODIFIER silent_mutation Average:19.927; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg1001508358 T -> DEL N N silent_mutation Average:19.927; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001508358 NA 1.72E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 8.94E-06 8.93E-06 mr1261 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 3.77E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 1.81E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 3.22E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 1.43E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 8.30E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 1.65E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 9.70E-07 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 3.22E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 1.02E-07 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 6.96E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 7.90E-08 NA mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 1.90E-09 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 1.69E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001508358 NA 7.87E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251