\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001478317:

Variant ID: vg1001478317 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1478317
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATTGGGATATGTACGGGAATTTAGCTGCAACAAACTTTTAAATTCAAGATTTAAAACTTTCAATTTATGTTCGAAAACTTGTAAGTCAAGATTTGAA[A/G]
CTTTCGACTCAAGATTTTTTTGAAATTTTCAACTTAAATTTGAAAATTCAAGTCTTAAAAACTTTCAACTTAGATCTGAAAACTTTCAACTCAAACTTAA

Reverse complement sequence

TTAAGTTTGAGTTGAAAGTTTTCAGATCTAAGTTGAAAGTTTTTAAGACTTGAATTTTCAAATTTAAGTTGAAAATTTCAAAAAAATCTTGAGTCGAAAG[T/C]
TTCAAATCTTGACTTACAAGTTTTCGAACATAAATTGAAAGTTTTAAATCTTGAATTTAAAAGTTTGTTGCAGCTAAATTCCCGTACATATCCCAATTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 4.40% 3.41% 17.73% NA
All Indica  2759 71.00% 0.10% 0.72% 28.16% NA
All Japonica  1512 77.10% 13.00% 8.86% 0.99% NA
Aus  269 87.40% 0.00% 0.74% 11.90% NA
Indica I  595 73.80% 0.00% 1.18% 25.04% NA
Indica II  465 71.00% 0.40% 1.08% 27.53% NA
Indica III  913 68.50% 0.00% 0.33% 31.22% NA
Indica Intermediate  786 71.90% 0.10% 0.64% 27.35% NA
Temperate Japonica  767 57.10% 24.90% 16.95% 1.04% NA
Tropical Japonica  504 98.60% 0.00% 0.20% 1.19% NA
Japonica Intermediate  241 95.90% 2.50% 1.24% 0.41% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 75.60% 6.70% 5.56% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001478317 A -> G LOC_Os10g03450.1 downstream_gene_variant ; 1377.0bp to feature; MODIFIER silent_mutation Average:19.001; most accessible tissue: Callus, score: 50.078 N N N N
vg1001478317 A -> G LOC_Os10g03460.1 downstream_gene_variant ; 4315.0bp to feature; MODIFIER silent_mutation Average:19.001; most accessible tissue: Callus, score: 50.078 N N N N
vg1001478317 A -> G LOC_Os10g03440-LOC_Os10g03450 intergenic_region ; MODIFIER silent_mutation Average:19.001; most accessible tissue: Callus, score: 50.078 N N N N
vg1001478317 A -> DEL N N silent_mutation Average:19.001; most accessible tissue: Callus, score: 50.078 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001478317 NA 7.91E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001478317 NA 1.87E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001478317 3.12E-06 1.46E-08 mr1825 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001478317 NA 4.71E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251