\
| Variant ID: vg1001478317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1478317 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAAATTGGGATATGTACGGGAATTTAGCTGCAACAAACTTTTAAATTCAAGATTTAAAACTTTCAATTTATGTTCGAAAACTTGTAAGTCAAGATTTGAA[A/G]
CTTTCGACTCAAGATTTTTTTGAAATTTTCAACTTAAATTTGAAAATTCAAGTCTTAAAAACTTTCAACTTAGATCTGAAAACTTTCAACTCAAACTTAA
TTAAGTTTGAGTTGAAAGTTTTCAGATCTAAGTTGAAAGTTTTTAAGACTTGAATTTTCAAATTTAAGTTGAAAATTTCAAAAAAATCTTGAGTCGAAAG[T/C]
TTCAAATCTTGACTTACAAGTTTTCGAACATAAATTGAAAGTTTTAAATCTTGAATTTAAAAGTTTGTTGCAGCTAAATTCCCGTACATATCCCAATTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 4.40% | 3.41% | 17.73% | NA |
| All Indica | 2759 | 71.00% | 0.10% | 0.72% | 28.16% | NA |
| All Japonica | 1512 | 77.10% | 13.00% | 8.86% | 0.99% | NA |
| Aus | 269 | 87.40% | 0.00% | 0.74% | 11.90% | NA |
| Indica I | 595 | 73.80% | 0.00% | 1.18% | 25.04% | NA |
| Indica II | 465 | 71.00% | 0.40% | 1.08% | 27.53% | NA |
| Indica III | 913 | 68.50% | 0.00% | 0.33% | 31.22% | NA |
| Indica Intermediate | 786 | 71.90% | 0.10% | 0.64% | 27.35% | NA |
| Temperate Japonica | 767 | 57.10% | 24.90% | 16.95% | 1.04% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.20% | 1.19% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.50% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 75.60% | 6.70% | 5.56% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001478317 | A -> G | LOC_Os10g03450.1 | downstream_gene_variant ; 1377.0bp to feature; MODIFIER | silent_mutation | Average:19.001; most accessible tissue: Callus, score: 50.078 | N | N | N | N |
| vg1001478317 | A -> G | LOC_Os10g03460.1 | downstream_gene_variant ; 4315.0bp to feature; MODIFIER | silent_mutation | Average:19.001; most accessible tissue: Callus, score: 50.078 | N | N | N | N |
| vg1001478317 | A -> G | LOC_Os10g03440-LOC_Os10g03450 | intergenic_region ; MODIFIER | silent_mutation | Average:19.001; most accessible tissue: Callus, score: 50.078 | N | N | N | N |
| vg1001478317 | A -> DEL | N | N | silent_mutation | Average:19.001; most accessible tissue: Callus, score: 50.078 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001478317 | NA | 7.91E-06 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001478317 | NA | 1.87E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001478317 | 3.12E-06 | 1.46E-08 | mr1825 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001478317 | NA | 4.71E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |