Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001467114:

Variant ID: vg1001467114 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1467114
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.12, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTAAGTTTCCCTAAGCATAGCCAGACTCATTTTATAGCTAAATATTGCTATGAGGCCATTTATTAATTGGCTACACTTTGTATGATTTGTCAGGTGGT[T/A]
AGCTGGCGCGTGCCGCTAGCGCGCACTCCTGCTTAACTACCTCTATTTGTTAACACTTGACAGTCATGACAGTAATTAGGAAAGATTATGAAGATTTTTC

Reverse complement sequence

GAAAAATCTTCATAATCTTTCCTAATTACTGTCATGACTGTCAAGTGTTAACAAATAGAGGTAGTTAAGCAGGAGTGCGCGCTAGCGGCACGCGCCAGCT[A/T]
ACCACCTGACAAATCATACAAAGTGTAGCCAATTAATAAATGGCCTCATAGCAATATTTAGCTATAAAATGAGTCTGGCTATGCTTAGGGAAACTTACGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	8.70%	1.16%	0.40%	NA
All Indica	2759	89.50%	10.40%	0.14%	0.00%	NA
All Japonica	1512	96.60%	0.10%	2.65%	0.66%	NA
Aus	269	57.60%	42.00%	0.37%	0.00%	NA
Indica I	595	98.70%	1.20%	0.17%	0.00%	NA
Indica II	465	95.10%	4.50%	0.43%	0.00%	NA
Indica III	913	80.70%	19.20%	0.11%	0.00%	NA
Indica Intermediate	786	89.40%	10.60%	0.00%	0.00%	NA
Temperate Japonica	767	96.50%	0.00%	3.13%	0.39%	NA
Tropical Japonica	504	97.80%	0.20%	1.19%	0.79%	NA
Japonica Intermediate	241	94.60%	0.00%	4.15%	1.24%	NA
VI/Aromatic	96	83.30%	3.10%	7.29%	6.25%	NA
Intermediate	90	85.60%	7.80%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001467114	T -> A	LOC_Os10g03440.1	upstream_gene_variant ; 1618.0bp to feature; MODIFIER	silent_mutation	Average:34.377; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N
vg1001467114	T -> A	LOC_Os10g03430.1	downstream_gene_variant ; 1175.0bp to feature; MODIFIER	silent_mutation	Average:34.377; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N
vg1001467114	T -> A	LOC_Os10g03430-LOC_Os10g03440	intergenic_region ; MODIFIER	silent_mutation	Average:34.377; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N
vg1001467114	T -> DEL	N	N	silent_mutation	Average:34.377; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001467114	2.51E-08	NA	mr1486	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001467114	8.50E-18	8.20E-15	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001467114	4.73E-10	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001467114	1.75E-15	9.67E-14	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001467114	NA	3.05E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001467114	6.39E-08	NA	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001467114	1.75E-09	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001467114	4.98E-21	4.79E-17	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001467114	2.56E-08	NA	mr1588_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001467114	4.76E-17	8.33E-09	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251