\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001459935:

Variant ID: vg1001459935 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1459935
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.34, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACGCGCGGGGTATCATCTAGTTTCTACTATGTTTCAAAAAAAATATATATTTCATTGACAACGAAATTACTTTTGAAAAGGCCACTGCACATTTGTA[C/T]
CTGGTTGGCAAATAAAAAAAATTTATGAGTTTTCCTTTTTTTTTTAGAAAAGAGATTTTAAGTTTCTCAAGATAAAATTAATTTCGGTAAATGGAATCCT

Reverse complement sequence

AGGATTCCATTTACCGAAATTAATTTTATCTTGAGAAACTTAAAATCTCTTTTCTAAAAAAAAAAGGAAAACTCATAAATTTTTTTTATTTGCCAACCAG[G/A]
TACAAATGTGCAGTGGCCTTTTCAAAAGTAATTTCGTTGTCAATGAAATATATATTTTTTTTGAAACATAGTAGAAACTAGATGATACCCCGCGCGTTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 10.70% 1.08% 25.84% NA
All Indica  2759 77.60% 10.00% 0.80% 11.60% NA
All Japonica  1512 41.30% 4.80% 1.19% 52.71% NA
Aus  269 45.00% 52.00% 1.12% 1.86% NA
Indica I  595 85.90% 1.30% 0.50% 12.27% NA
Indica II  465 91.20% 2.20% 0.43% 6.24% NA
Indica III  913 67.10% 17.40% 1.10% 14.35% NA
Indica Intermediate  786 75.30% 12.70% 0.89% 11.07% NA
Temperate Japonica  767 72.40% 0.00% 0.91% 26.73% NA
Tropical Japonica  504 5.60% 13.50% 1.59% 79.37% NA
Japonica Intermediate  241 17.40% 1.70% 1.24% 79.67% NA
VI/Aromatic  96 20.80% 2.10% 8.33% 68.75% NA
Intermediate  90 48.90% 14.40% 0.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001459935 C -> T LOC_Os10g03430.1 upstream_gene_variant ; 4759.0bp to feature; MODIFIER silent_mutation Average:27.173; most accessible tissue: Callus, score: 56.455 N N N N
vg1001459935 C -> T LOC_Os10g03420.1 downstream_gene_variant ; 2833.0bp to feature; MODIFIER silent_mutation Average:27.173; most accessible tissue: Callus, score: 56.455 N N N N
vg1001459935 C -> T LOC_Os10g03420-LOC_Os10g03430 intergenic_region ; MODIFIER silent_mutation Average:27.173; most accessible tissue: Callus, score: 56.455 N N N N
vg1001459935 C -> DEL N N silent_mutation Average:27.173; most accessible tissue: Callus, score: 56.455 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001459935 1.65E-10 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935 1.13E-18 4.20E-17 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935 6.02E-10 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935 1.38E-16 1.75E-15 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935 5.39E-06 NA mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935 7.05E-10 6.89E-09 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935 2.30E-10 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935 3.23E-18 8.67E-15 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935 1.22E-09 NA mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935 5.75E-18 2.09E-15 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251