\
| Variant ID: vg1001459935 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1459935 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.34, others allele: 0.00, population size: 59. )
GCAACGCGCGGGGTATCATCTAGTTTCTACTATGTTTCAAAAAAAATATATATTTCATTGACAACGAAATTACTTTTGAAAAGGCCACTGCACATTTGTA[C/T]
CTGGTTGGCAAATAAAAAAAATTTATGAGTTTTCCTTTTTTTTTTAGAAAAGAGATTTTAAGTTTCTCAAGATAAAATTAATTTCGGTAAATGGAATCCT
AGGATTCCATTTACCGAAATTAATTTTATCTTGAGAAACTTAAAATCTCTTTTCTAAAAAAAAAAGGAAAACTCATAAATTTTTTTTATTTGCCAACCAG[G/A]
TACAAATGTGCAGTGGCCTTTTCAAAAGTAATTTCGTTGTCAATGAAATATATATTTTTTTTGAAACATAGTAGAAACTAGATGATACCCCGCGCGTTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 10.70% | 1.08% | 25.84% | NA |
| All Indica | 2759 | 77.60% | 10.00% | 0.80% | 11.60% | NA |
| All Japonica | 1512 | 41.30% | 4.80% | 1.19% | 52.71% | NA |
| Aus | 269 | 45.00% | 52.00% | 1.12% | 1.86% | NA |
| Indica I | 595 | 85.90% | 1.30% | 0.50% | 12.27% | NA |
| Indica II | 465 | 91.20% | 2.20% | 0.43% | 6.24% | NA |
| Indica III | 913 | 67.10% | 17.40% | 1.10% | 14.35% | NA |
| Indica Intermediate | 786 | 75.30% | 12.70% | 0.89% | 11.07% | NA |
| Temperate Japonica | 767 | 72.40% | 0.00% | 0.91% | 26.73% | NA |
| Tropical Japonica | 504 | 5.60% | 13.50% | 1.59% | 79.37% | NA |
| Japonica Intermediate | 241 | 17.40% | 1.70% | 1.24% | 79.67% | NA |
| VI/Aromatic | 96 | 20.80% | 2.10% | 8.33% | 68.75% | NA |
| Intermediate | 90 | 48.90% | 14.40% | 0.00% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001459935 | C -> T | LOC_Os10g03430.1 | upstream_gene_variant ; 4759.0bp to feature; MODIFIER | silent_mutation | Average:27.173; most accessible tissue: Callus, score: 56.455 | N | N | N | N |
| vg1001459935 | C -> T | LOC_Os10g03420.1 | downstream_gene_variant ; 2833.0bp to feature; MODIFIER | silent_mutation | Average:27.173; most accessible tissue: Callus, score: 56.455 | N | N | N | N |
| vg1001459935 | C -> T | LOC_Os10g03420-LOC_Os10g03430 | intergenic_region ; MODIFIER | silent_mutation | Average:27.173; most accessible tissue: Callus, score: 56.455 | N | N | N | N |
| vg1001459935 | C -> DEL | N | N | silent_mutation | Average:27.173; most accessible tissue: Callus, score: 56.455 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001459935 | 1.65E-10 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001459935 | 1.13E-18 | 4.20E-17 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001459935 | 6.02E-10 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001459935 | 1.38E-16 | 1.75E-15 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001459935 | 5.39E-06 | NA | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001459935 | 7.05E-10 | 6.89E-09 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001459935 | 2.30E-10 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001459935 | 3.23E-18 | 8.67E-15 | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001459935 | 1.22E-09 | NA | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001459935 | 5.75E-18 | 2.09E-15 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |