Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001459935:

Variant ID: vg1001459935 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1459935
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.34, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

GCAACGCGCGGGGTATCATCTAGTTTCTACTATGTTTCAAAAAAAATATATATTTCATTGACAACGAAATTACTTTTGAAAAGGCCACTGCACATTTGTA[C/T]
CTGGTTGGCAAATAAAAAAAATTTATGAGTTTTCCTTTTTTTTTTAGAAAAGAGATTTTAAGTTTCTCAAGATAAAATTAATTTCGGTAAATGGAATCCT

Reverse complement sequence

AGGATTCCATTTACCGAAATTAATTTTATCTTGAGAAACTTAAAATCTCTTTTCTAAAAAAAAAAGGAAAACTCATAAATTTTTTTTATTTGCCAACCAG[G/A]
TACAAATGTGCAGTGGCCTTTTCAAAAGTAATTTCGTTGTCAATGAAATATATATTTTTTTTGAAACATAGTAGAAACTAGATGATACCCCGCGCGTTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	10.70%	1.08%	25.84%	NA
All Indica	2759	77.60%	10.00%	0.80%	11.60%	NA
All Japonica	1512	41.30%	4.80%	1.19%	52.71%	NA
Aus	269	45.00%	52.00%	1.12%	1.86%	NA
Indica I	595	85.90%	1.30%	0.50%	12.27%	NA
Indica II	465	91.20%	2.20%	0.43%	6.24%	NA
Indica III	913	67.10%	17.40%	1.10%	14.35%	NA
Indica Intermediate	786	75.30%	12.70%	0.89%	11.07%	NA
Temperate Japonica	767	72.40%	0.00%	0.91%	26.73%	NA
Tropical Japonica	504	5.60%	13.50%	1.59%	79.37%	NA
Japonica Intermediate	241	17.40%	1.70%	1.24%	79.67%	NA
VI/Aromatic	96	20.80%	2.10%	8.33%	68.75%	NA
Intermediate	90	48.90%	14.40%	0.00%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001459935	C -> T	LOC_Os10g03430.1	upstream_gene_variant ; 4759.0bp to feature; MODIFIER	silent_mutation	Average:27.173; most accessible tissue: Callus, score: 56.455	N	N	N	N
vg1001459935	C -> T	LOC_Os10g03420.1	downstream_gene_variant ; 2833.0bp to feature; MODIFIER	silent_mutation	Average:27.173; most accessible tissue: Callus, score: 56.455	N	N	N	N
vg1001459935	C -> T	LOC_Os10g03420-LOC_Os10g03430	intergenic_region ; MODIFIER	silent_mutation	Average:27.173; most accessible tissue: Callus, score: 56.455	N	N	N	N
vg1001459935	C -> DEL	N	N	silent_mutation	Average:27.173; most accessible tissue: Callus, score: 56.455	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001459935	1.65E-10	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935	1.13E-18	4.20E-17	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935	6.02E-10	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935	1.38E-16	1.75E-15	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935	5.39E-06	NA	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935	7.05E-10	6.89E-09	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935	2.30E-10	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935	3.23E-18	8.67E-15	mr1486_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935	1.22E-09	NA	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001459935	5.75E-18	2.09E-15	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251