\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001446636:

Variant ID: vg1001446636 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1446636
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTTAATTAGATCGATTTAAAACACAACTAATCATTAGCATTGCTAAATATATTTATATAAAAAAAGCCTTACAATACTTTTACGAATAAAGTTCTCAA[C/T]
ATTTGATTTGACTATAAGAATTATAGAAAAAATATACTCATGTACAACTGAAACATTTTTTTTCCTAAATAAATGTTAGCGAGACAGTTGTGGGTTGTTT

Reverse complement sequence

AAACAACCCACAACTGTCTCGCTAACATTTATTTAGGAAAAAAAATGTTTCAGTTGTACATGAGTATATTTTTTCTATAATTCTTATAGTCAAATCAAAT[G/A]
TTGAGAACTTTATTCGTAAAAGTATTGTAAGGCTTTTTTTATATAAATATATTTAGCAATGCTAATGATTAGTTGTGTTTTAAATCGATCTAATTAACAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 25.40% 0.85% 26.85% NA
All Indica  2759 56.70% 30.00% 0.83% 12.43% NA
All Japonica  1512 40.10% 5.30% 0.79% 53.84% NA
Aus  269 0.70% 96.30% 0.00% 2.97% NA
Indica I  595 59.70% 27.10% 0.34% 12.94% NA
Indica II  465 63.40% 28.80% 1.08% 6.67% NA
Indica III  913 51.70% 32.20% 1.10% 15.01% NA
Indica Intermediate  786 56.20% 30.50% 0.76% 12.47% NA
Temperate Japonica  767 71.10% 0.30% 0.65% 28.03% NA
Tropical Japonica  504 5.00% 13.70% 0.99% 80.36% NA
Japonica Intermediate  241 14.90% 3.70% 0.83% 80.50% NA
VI/Aromatic  96 9.40% 14.60% 2.08% 73.96% NA
Intermediate  90 37.80% 22.20% 3.33% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001446636 C -> T LOC_Os10g03390.1 downstream_gene_variant ; 1315.0bp to feature; MODIFIER silent_mutation Average:53.381; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1001446636 C -> T LOC_Os10g03400.2 downstream_gene_variant ; 724.0bp to feature; MODIFIER silent_mutation Average:53.381; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1001446636 C -> T LOC_Os10g03390-LOC_Os10g03400 intergenic_region ; MODIFIER silent_mutation Average:53.381; most accessible tissue: Minghui63 root, score: 77.832 N N N N
vg1001446636 C -> DEL N N silent_mutation Average:53.381; most accessible tissue: Minghui63 root, score: 77.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001446636 8.63E-09 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 2.51E-10 1.25E-12 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 NA 1.99E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 4.90E-08 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 4.91E-09 1.07E-10 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 3.02E-06 1.93E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 2.02E-06 2.02E-06 mr1687 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 NA 7.68E-07 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 2.15E-08 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 2.05E-10 2.08E-12 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 2.63E-07 NA mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001446636 2.11E-06 2.09E-09 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251