\
| Variant ID: vg1001446636 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1446636 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 62. )
GTGTTAATTAGATCGATTTAAAACACAACTAATCATTAGCATTGCTAAATATATTTATATAAAAAAAGCCTTACAATACTTTTACGAATAAAGTTCTCAA[C/T]
ATTTGATTTGACTATAAGAATTATAGAAAAAATATACTCATGTACAACTGAAACATTTTTTTTCCTAAATAAATGTTAGCGAGACAGTTGTGGGTTGTTT
AAACAACCCACAACTGTCTCGCTAACATTTATTTAGGAAAAAAAATGTTTCAGTTGTACATGAGTATATTTTTTCTATAATTCTTATAGTCAAATCAAAT[G/A]
TTGAGAACTTTATTCGTAAAAGTATTGTAAGGCTTTTTTTATATAAATATATTTAGCAATGCTAATGATTAGTTGTGTTTTAAATCGATCTAATTAACAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.90% | 25.40% | 0.85% | 26.85% | NA |
| All Indica | 2759 | 56.70% | 30.00% | 0.83% | 12.43% | NA |
| All Japonica | 1512 | 40.10% | 5.30% | 0.79% | 53.84% | NA |
| Aus | 269 | 0.70% | 96.30% | 0.00% | 2.97% | NA |
| Indica I | 595 | 59.70% | 27.10% | 0.34% | 12.94% | NA |
| Indica II | 465 | 63.40% | 28.80% | 1.08% | 6.67% | NA |
| Indica III | 913 | 51.70% | 32.20% | 1.10% | 15.01% | NA |
| Indica Intermediate | 786 | 56.20% | 30.50% | 0.76% | 12.47% | NA |
| Temperate Japonica | 767 | 71.10% | 0.30% | 0.65% | 28.03% | NA |
| Tropical Japonica | 504 | 5.00% | 13.70% | 0.99% | 80.36% | NA |
| Japonica Intermediate | 241 | 14.90% | 3.70% | 0.83% | 80.50% | NA |
| VI/Aromatic | 96 | 9.40% | 14.60% | 2.08% | 73.96% | NA |
| Intermediate | 90 | 37.80% | 22.20% | 3.33% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001446636 | C -> T | LOC_Os10g03390.1 | downstream_gene_variant ; 1315.0bp to feature; MODIFIER | silent_mutation | Average:53.381; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| vg1001446636 | C -> T | LOC_Os10g03400.2 | downstream_gene_variant ; 724.0bp to feature; MODIFIER | silent_mutation | Average:53.381; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| vg1001446636 | C -> T | LOC_Os10g03390-LOC_Os10g03400 | intergenic_region ; MODIFIER | silent_mutation | Average:53.381; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| vg1001446636 | C -> DEL | N | N | silent_mutation | Average:53.381; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001446636 | 8.63E-09 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | 2.51E-10 | 1.25E-12 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | NA | 1.99E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | 4.90E-08 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | 4.91E-09 | 1.07E-10 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | 3.02E-06 | 1.93E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | 2.02E-06 | 2.02E-06 | mr1687 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | NA | 7.68E-07 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | 2.15E-08 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | 2.05E-10 | 2.08E-12 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | 2.63E-07 | NA | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001446636 | 2.11E-06 | 2.09E-09 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |