\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001445274:

Variant ID: vg1001445274 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1445274
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCAGAGTGGGGTGCGGCCGCTGTGCGTGGTTTGTCTGCCATGGCAAGGGGAGGAAGATGAAGGAGCCAGGGTGCTGTCCGGCTGTGTAACGCCTCACCA[T/A]
GCCGATGCTTTTCTCCGTGAAATAGCTACGCTCTGATCTCGATCGATCTCCAAATATGTACTTTATAATGCACTTATATATGTGCCACCATATAATAATT

Reverse complement sequence

AATTATTATATGGTGGCACATATATAAGTGCATTATAAAGTACATATTTGGAGATCGATCGAGATCAGAGCGTAGCTATTTCACGGAGAAAAGCATCGGC[A/T]
TGGTGAGGCGTTACACAGCCGGACAGCACCCTGGCTCCTTCATCTTCCTCCCCTTGCCATGGCAGACAAACCACGCACAGCGGCCGCACCCCACTCTGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 3.40% 4.91% 17.22% NA
All Indica  2759 88.10% 0.80% 4.46% 6.63% NA
All Japonica  1512 49.40% 7.30% 6.02% 37.24% NA
Aus  269 97.00% 0.70% 2.23% 0.00% NA
Indica I  595 87.70% 0.80% 4.03% 7.39% NA
Indica II  465 93.50% 1.50% 1.29% 3.66% NA
Indica III  913 85.40% 0.10% 6.46% 8.00% NA
Indica Intermediate  786 88.20% 1.30% 4.33% 6.23% NA
Temperate Japonica  767 73.30% 6.50% 3.26% 16.95% NA
Tropical Japonica  504 26.00% 7.10% 10.32% 56.55% NA
Japonica Intermediate  241 22.40% 10.40% 5.81% 61.41% NA
VI/Aromatic  96 25.00% 15.60% 5.21% 54.17% NA
Intermediate  90 63.30% 11.10% 7.78% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001445274 T -> A LOC_Os10g03390.1 missense_variant ; p.His411Gln; MODERATE nonsynonymous_codon ; H411Q Average:65.569; most accessible tissue: Zhenshan97 young leaf, score: 81.102 unknown unknown DELETERIOUS 0.00
vg1001445274 T -> DEL LOC_Os10g03390.1 N frameshift_variant Average:65.569; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001445274 9.25E-06 9.25E-06 mr1173 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 2.59E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 1.54E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 7.64E-06 7.63E-06 mr1261 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 5.92E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 3.92E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 7.62E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 9.07E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 6.37E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 3.23E-09 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 2.33E-06 2.32E-06 mr1954 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 8.97E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 1.54E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 NA 5.33E-07 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 1.67E-06 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001445274 7.04E-06 2.63E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251