\
| Variant ID: vg1001440523 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1440523 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )
TTCAAGTGCCGTGCAAGTATTGCCAAGCATGGATTGTGGCCAGAGAAAGCAATTGAATCTATTAATTAGGATATTCTAGTAGTTTCATTATAGATATTTT[C/T]
GGTAAGAGTCCGCCTGAGGGACTTGTTCGTATTTTTGAGTTGTAATAGAGATAGAGTCGTGTTCGGCAAGGACATATCATGTATTTTGGGTATAAATATG
CATATTTATACCCAAAATACATGATATGTCCTTGCCGAACACGACTCTATCTCTATTACAACTCAAAAATACGAACAAGTCCCTCAGGCGGACTCTTACC[G/A]
AAAATATCTATAATGAAACTACTAGAATATCCTAATTAATAGATTCAATTGCTTTCTCTGGCCACAATCCATGCTTGGCAATACTTGCACGGCACTTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 8.10% | 0.02% | 0.91% | NA |
| All Indica | 2759 | 85.40% | 13.60% | 0.04% | 0.98% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.00% | 0.13% | NA |
| Aus | 269 | 97.80% | 0.00% | 0.00% | 2.23% | NA |
| Indica I | 595 | 85.70% | 14.10% | 0.00% | 0.17% | NA |
| Indica II | 465 | 95.30% | 4.50% | 0.00% | 0.22% | NA |
| Indica III | 913 | 78.10% | 19.50% | 0.00% | 2.41% | NA |
| Indica Intermediate | 786 | 87.70% | 11.80% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001440523 | C -> T | LOC_Os10g03380.1 | upstream_gene_variant ; 1196.0bp to feature; MODIFIER | silent_mutation | Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg1001440523 | C -> T | LOC_Os10g03390.1 | upstream_gene_variant ; 3479.0bp to feature; MODIFIER | silent_mutation | Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg1001440523 | C -> T | LOC_Os10g03370.1 | downstream_gene_variant ; 3829.0bp to feature; MODIFIER | silent_mutation | Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg1001440523 | C -> T | LOC_Os10g03380-LOC_Os10g03390 | intergenic_region ; MODIFIER | silent_mutation | Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg1001440523 | C -> DEL | N | N | silent_mutation | Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001440523 | 2.81E-08 | NA | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001440523 | 8.01E-09 | 1.07E-06 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001440523 | 4.28E-11 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001440523 | 1.47E-09 | 2.35E-08 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001440523 | 7.36E-06 | NA | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001440523 | 9.97E-07 | NA | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001440523 | 9.92E-10 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001440523 | 4.48E-11 | 4.15E-07 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001440523 | 2.49E-10 | NA | mr1588_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001440523 | 2.60E-12 | 1.79E-06 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |