\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001440523:

Variant ID: vg1001440523 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1440523
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAGTGCCGTGCAAGTATTGCCAAGCATGGATTGTGGCCAGAGAAAGCAATTGAATCTATTAATTAGGATATTCTAGTAGTTTCATTATAGATATTTT[C/T]
GGTAAGAGTCCGCCTGAGGGACTTGTTCGTATTTTTGAGTTGTAATAGAGATAGAGTCGTGTTCGGCAAGGACATATCATGTATTTTGGGTATAAATATG

Reverse complement sequence

CATATTTATACCCAAAATACATGATATGTCCTTGCCGAACACGACTCTATCTCTATTACAACTCAAAAATACGAACAAGTCCCTCAGGCGGACTCTTACC[G/A]
AAAATATCTATAATGAAACTACTAGAATATCCTAATTAATAGATTCAATTGCTTTCTCTGGCCACAATCCATGCTTGGCAATACTTGCACGGCACTTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 8.10% 0.02% 0.91% NA
All Indica  2759 85.40% 13.60% 0.04% 0.98% NA
All Japonica  1512 99.80% 0.10% 0.00% 0.13% NA
Aus  269 97.80% 0.00% 0.00% 2.23% NA
Indica I  595 85.70% 14.10% 0.00% 0.17% NA
Indica II  465 95.30% 4.50% 0.00% 0.22% NA
Indica III  913 78.10% 19.50% 0.00% 2.41% NA
Indica Intermediate  786 87.70% 11.80% 0.13% 0.38% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 93.30% 5.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001440523 C -> T LOC_Os10g03380.1 upstream_gene_variant ; 1196.0bp to feature; MODIFIER silent_mutation Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg1001440523 C -> T LOC_Os10g03390.1 upstream_gene_variant ; 3479.0bp to feature; MODIFIER silent_mutation Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg1001440523 C -> T LOC_Os10g03370.1 downstream_gene_variant ; 3829.0bp to feature; MODIFIER silent_mutation Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg1001440523 C -> T LOC_Os10g03380-LOC_Os10g03390 intergenic_region ; MODIFIER silent_mutation Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg1001440523 C -> DEL N N silent_mutation Average:32.651; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001440523 2.81E-08 NA mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001440523 8.01E-09 1.07E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001440523 4.28E-11 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001440523 1.47E-09 2.35E-08 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001440523 7.36E-06 NA mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001440523 9.97E-07 NA mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001440523 9.92E-10 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001440523 4.48E-11 4.15E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001440523 2.49E-10 NA mr1588_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001440523 2.60E-12 1.79E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251