\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001438303:

Variant ID: vg1001438303 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1438303
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGAGAATCTGGAGAAGCTGTGAAACCCAGCTTCTGGCTTCTAGTTCATTTTCCAGATTCTACAACTACAGTTTCTCAGAATCTGGATAAAAAGTTGGA[T/C]
TGTTTGGGGGAGCTTCTGGACCTTCTGGGCCATAGTCCAGAAGCTCTCCCGCTGCCTTCTCCTGTTTGTGAAGCATGTAGGGGCCACCGTTGCGGTTGCT

Reverse complement sequence

AGCAACCGCAACGGTGGCCCCTACATGCTTCACAAACAGGAGAAGGCAGCGGGAGAGCTTCTGGACTATGGCCCAGAAGGTCCAGAAGCTCCCCCAAACA[A/G]
TCCAACTTTTTATCCAGATTCTGAGAAACTGTAGTTGTAGAATCTGGAAAATGAACTAGAAGCCAGAAGCTGGGTTTCACAGCTTCTCCAGATTCTCACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 14.50% 0.06% 0.91% NA
All Indica  2759 95.50% 3.50% 0.07% 0.98% NA
All Japonica  1512 62.00% 37.80% 0.00% 0.13% NA
Aus  269 97.80% 0.00% 0.00% 2.23% NA
Indica I  595 97.50% 2.40% 0.00% 0.17% NA
Indica II  465 98.70% 1.10% 0.00% 0.22% NA
Indica III  913 92.10% 5.40% 0.11% 2.41% NA
Indica Intermediate  786 95.90% 3.60% 0.13% 0.38% NA
Temperate Japonica  767 30.00% 70.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 11.60% 0.00% 0.83% NA
VI/Aromatic  96 88.50% 4.20% 0.00% 7.29% NA
Intermediate  90 84.40% 13.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001438303 T -> C LOC_Os10g03380.1 missense_variant ; p.Asn40Ser; MODERATE nonsynonymous_codon Average:60.243; most accessible tissue: Callus, score: 85.786 unknown unknown DELETERIOUS 0.00
vg1001438303 T -> DEL LOC_Os10g03380.1 N frameshift_variant Average:60.243; most accessible tissue: Callus, score: 85.786 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001438303 NA 3.74E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 8.80E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 6.49E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 1.04E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 1.18E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 1.51E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 8.78E-25 4.37E-65 mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 1.13E-14 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 8.28E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 2.80E-23 8.50E-43 mr1548 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 1.01E-09 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 5.44E-10 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 2.67E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 2.16E-09 1.58E-23 mr1588 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 4.58E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 7.31E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 1.43E-23 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 4.69E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 4.07E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 5.78E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 1.20E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 2.08E-06 3.55E-35 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 7.18E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 3.23E-35 7.32E-77 mr1486_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 6.45E-10 1.02E-18 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 2.24E-19 2.94E-35 mr1588_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 9.20E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 1.60E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001438303 NA 6.22E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251