\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001435000:

Variant ID: vg1001435000 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1435000
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGGCAGTTGTAAAACATTTTATTGAGCAAAAAAGTAAAACTGTTGATTAATTAAGGTAGCATTAAATCTCCACTGATCAACGCTACACCACGTTGAA[T/C]
AGGCCCAACCAACCCACCTGAACTACAGTGCATTTAGTCGATTTATTAAGTGTGAGACTAATCACAGTGAATCTGGTCGATCGCCCATAACTGCGGGCAC

Reverse complement sequence

GTGCCCGCAGTTATGGGCGATCGACCAGATTCACTGTGATTAGTCTCACACTTAATAAATCGACTAAATGCACTGTAGTTCAGGTGGGTTGGTTGGGCCT[A/G]
TTCAACGTGGTGTAGCGTTGATCAGTGGAGATTTAATGCTACCTTAATTAATCAACAGTTTTACTTTTTTGCTCAATAAAATGTTTTACAACTGCCTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 17.20% 0.00% 0.00% NA
All Indica  2759 93.10% 6.90% 0.00% 0.00% NA
All Japonica  1512 62.10% 37.90% 0.00% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 85.00% 15.00% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.50% 0.00% 0.00% NA
Temperate Japonica  767 30.00% 70.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 88.00% 12.00% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001435000 T -> C LOC_Os10g03370.1 upstream_gene_variant ; 1272.0bp to feature; MODIFIER silent_mutation Average:42.515; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg1001435000 T -> C LOC_Os10g03360.1 downstream_gene_variant ; 2593.0bp to feature; MODIFIER silent_mutation Average:42.515; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg1001435000 T -> C LOC_Os10g03380.1 downstream_gene_variant ; 3269.0bp to feature; MODIFIER silent_mutation Average:42.515; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg1001435000 T -> C LOC_Os10g03360-LOC_Os10g03370 intergenic_region ; MODIFIER silent_mutation Average:42.515; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001435000 NA 3.49E-15 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1001435000 NA 3.74E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 8.80E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 6.49E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 1.04E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 2.03E-06 NA mr1304 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 1.18E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 1.51E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 1.13E-14 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 8.28E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 1.01E-09 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 5.44E-10 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 3.54E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 2.15E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 4.58E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 1.05E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 2.91E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 7.44E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 5.78E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 1.20E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 7.18E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 7.99E-08 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 6.45E-10 1.02E-18 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 9.20E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 1.44E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001435000 NA 6.22E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251