\
| Variant ID: vg1001434429 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1434429 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAGCGGAGGAGGGGATCGAGCTTATCAGTGAGGAGCTCTCTCTCTCTCTCTCTTTGGTGGAGGCGGCTATAAGCTCAGGTCCGATGTGTTGGGAGGAGG[C/T]
ACCTGAAGGCTCAGGCTAGTTGCGGTGGTCGACAGTCAAAGCGGTCGAAGAAGTCTAGGGTGGTGGTGGAGACTGGTGTCACGCCCAGAAATTTAGCCCA
TGGGCTAAATTTCTGGGCGTGACACCAGTCTCCACCACCACCCTAGACTTCTTCGACCGCTTTGACTGTCGACCACCGCAACTAGCCTGAGCCTTCAGGT[G/A]
CCTCCTCCCAACACATCGGACCTGAGCTTATAGCCGCCTCCACCAAAGAGAGAGAGAGAGAGAGCTCCTCACTGATAAGCTCGATCCCCTCCTCCGCTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001434429 | C -> T | LOC_Os10g03370.1 | upstream_gene_variant ; 1843.0bp to feature; MODIFIER | silent_mutation | Average:63.937; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg1001434429 | C -> T | LOC_Os10g03360.1 | downstream_gene_variant ; 2022.0bp to feature; MODIFIER | silent_mutation | Average:63.937; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg1001434429 | C -> T | LOC_Os10g03380.1 | downstream_gene_variant ; 3840.0bp to feature; MODIFIER | silent_mutation | Average:63.937; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg1001434429 | C -> T | LOC_Os10g03360-LOC_Os10g03370 | intergenic_region ; MODIFIER | silent_mutation | Average:63.937; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001434429 | 3.57E-09 | 7.54E-07 | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001434429 | 1.44E-14 | 5.06E-12 | mr1548 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001434429 | 1.07E-10 | 1.65E-09 | mr1588 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001434429 | 7.06E-11 | 3.36E-06 | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001434429 | 5.27E-16 | 4.72E-12 | mr1588_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |