\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001434429:

Variant ID: vg1001434429 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1434429
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGCGGAGGAGGGGATCGAGCTTATCAGTGAGGAGCTCTCTCTCTCTCTCTCTTTGGTGGAGGCGGCTATAAGCTCAGGTCCGATGTGTTGGGAGGAGG[C/T]
ACCTGAAGGCTCAGGCTAGTTGCGGTGGTCGACAGTCAAAGCGGTCGAAGAAGTCTAGGGTGGTGGTGGAGACTGGTGTCACGCCCAGAAATTTAGCCCA

Reverse complement sequence

TGGGCTAAATTTCTGGGCGTGACACCAGTCTCCACCACCACCCTAGACTTCTTCGACCGCTTTGACTGTCGACCACCGCAACTAGCCTGAGCCTTCAGGT[G/A]
CCTCCTCCCAACACATCGGACCTGAGCTTATAGCCGCCTCCACCAAAGAGAGAGAGAGAGAGAGCTCCTCACTGATAAGCTCGATCCCCTCCTCCGCTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 3.90% 0.00% 0.00% NA
All Indica  2759 93.40% 6.60% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.70% 14.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 94.30% 5.70% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001434429 C -> T LOC_Os10g03370.1 upstream_gene_variant ; 1843.0bp to feature; MODIFIER silent_mutation Average:63.937; most accessible tissue: Minghui63 flag leaf, score: 74.563 N N N N
vg1001434429 C -> T LOC_Os10g03360.1 downstream_gene_variant ; 2022.0bp to feature; MODIFIER silent_mutation Average:63.937; most accessible tissue: Minghui63 flag leaf, score: 74.563 N N N N
vg1001434429 C -> T LOC_Os10g03380.1 downstream_gene_variant ; 3840.0bp to feature; MODIFIER silent_mutation Average:63.937; most accessible tissue: Minghui63 flag leaf, score: 74.563 N N N N
vg1001434429 C -> T LOC_Os10g03360-LOC_Os10g03370 intergenic_region ; MODIFIER silent_mutation Average:63.937; most accessible tissue: Minghui63 flag leaf, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001434429 3.57E-09 7.54E-07 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001434429 1.44E-14 5.06E-12 mr1548 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001434429 1.07E-10 1.65E-09 mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001434429 7.06E-11 3.36E-06 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001434429 5.27E-16 4.72E-12 mr1588_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251