Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001432912:

Variant ID: vg1001432912 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1432912
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGCACCTATCTTCCGGGCCGTCATGGTTGAGGAAGAAACCGGAGGGTGTTCGTAGCAAACGCCCTAAGGTATAGATGGCCATAAAACCCGCCCGTCAT[A/G]
GTCTGGCCCAGGCACGGCCCGGTCGACATTACGTGCCGAGCTGTGCCGGCCCATGTGCTGCACCTCCGCCCAGGCACGGCCCACCAGCAGTCGGGCCGTG

Reverse complement sequence

CACGGCCCGACTGCTGGTGGGCCGTGCCTGGGCGGAGGTGCAGCACATGGGCCGGCACAGCTCGGCACGTAATGTCGACCGGGCCGTGCCTGGGCCAGAC[T/C]
ATGACGGGCGGGTTTTATGGCCATCTATACCTTAGGGCGTTTGCTACGAACACCCTCCGGTTTCTTCCTCAACCATGACGGCCCGGAAGATAGGTGCAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 12.70% 1.95% 1.31% NA
All Indica  2759 94.50% 0.60% 2.72% 2.14% NA
All Japonica  1512 62.00% 37.70% 0.20% 0.07% NA
Aus  269 97.80% 0.00% 2.23% 0.00% NA
Indica I  595 93.90% 1.00% 2.86% 2.18% NA
Indica II  465 92.70% 0.60% 3.01% 3.66% NA
Indica III  913 94.50% 0.40% 3.29% 1.75% NA
Indica Intermediate  786 96.10% 0.50% 1.78% 1.65% NA
Temperate Japonica  767 30.10% 69.90% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.00% 0.20% NA
Japonica Intermediate  241 87.60% 11.20% 1.24% 0.00% NA
VI/Aromatic  96 89.60% 3.10% 7.29% 0.00% NA
Intermediate  90 84.40% 12.20% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001432912 A -> G LOC_Os10g03370.1 upstream_gene_variant ; 3360.0bp to feature; MODIFIER silent_mutation Average:81.862; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N
vg1001432912 A -> G LOC_Os10g03360.1 downstream_gene_variant ; 505.0bp to feature; MODIFIER silent_mutation Average:81.862; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N
vg1001432912 A -> G LOC_Os10g03360-LOC_Os10g03370 intergenic_region ; MODIFIER silent_mutation Average:81.862; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N
vg1001432912 A -> DEL N N silent_mutation Average:81.862; most accessible tissue: Zhenshan97 panicle, score: 93.845 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1001432912 A G 0.02 0.02 0.02 0.03 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001432912 NA 6.66E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 3.74E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 8.80E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 6.49E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 1.04E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 6.82E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 1.18E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 1.51E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 2.18E-07 2.12E-43 mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 1.13E-14 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 8.28E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 5.04E-06 2.66E-24 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 1.01E-09 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 5.44E-10 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 7.66E-23 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 4.58E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 4.79E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 8.23E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 4.14E-12 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 1.14E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 5.78E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 1.20E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 2.51E-07 1.67E-39 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 7.18E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 6.90E-13 3.41E-54 mr1486_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 6.45E-10 1.02E-18 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 9.20E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 4.51E-19 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001432912 NA 6.22E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251