\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001428880:

Variant ID: vg1001428880 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1428880
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.44, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


CTATGTAACATTCGAAAGTTTTTTTTAGGACTTTCAGATATAACTCTAATACCATTATATCGTAACTACTATATAAGTACTATGCAACAACTATATATTT[T/C]
CAAAAAAAATTAAAACCCTACTATATAAGGACTATGTAAGTGGTATGTAACTGTCGAAAAAATTTATGAGTACAAGTGGCTAGCGCAGCTACCCCTCGAG

Reverse complement sequence

CTCGAGGGGTAGCTGCGCTAGCCACTTGTACTCATAAATTTTTTCGACAGTTACATACCACTTACATAGTCCTTATATAGTAGGGTTTTAATTTTTTTTG[A/G]
AAATATATAGTTGTTGCATAGTACTTATATAGTAGTTACGATATAATGGTATTAGAGTTATATCTGAAAGTCCTAAAAAAAACTTTCGAATGTTACATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 28.50% 0.30% 9.59% NA
All Indica  2759 65.40% 27.00% 0.43% 7.14% NA
All Japonica  1512 57.00% 38.20% 0.13% 4.70% NA
Aus  269 34.90% 1.50% 0.00% 63.57% NA
Indica I  595 58.30% 41.00% 0.67% 0.00% NA
Indica II  465 69.20% 29.00% 0.22% 1.51% NA
Indica III  913 68.00% 19.60% 0.44% 11.94% NA
Indica Intermediate  786 65.50% 23.80% 0.38% 10.31% NA
Temperate Japonica  767 29.70% 70.30% 0.00% 0.00% NA
Tropical Japonica  504 84.70% 1.60% 0.40% 13.29% NA
Japonica Intermediate  241 85.90% 12.40% 0.00% 1.66% NA
VI/Aromatic  96 91.70% 4.20% 0.00% 4.17% NA
Intermediate  90 68.90% 20.00% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001428880 T -> C LOC_Os10g03360.1 upstream_gene_variant ; 2262.0bp to feature; MODIFIER silent_mutation Average:65.398; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1001428880 T -> C LOC_Os10g03350-LOC_Os10g03360 intergenic_region ; MODIFIER silent_mutation Average:65.398; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1001428880 T -> DEL N N silent_mutation Average:65.398; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001428880 NA 3.74E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 8.80E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 6.49E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 1.04E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 1.18E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 1.51E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 1.03E-11 1.09E-15 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 1.13E-14 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 8.28E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 2.06E-08 1.38E-10 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 1.01E-09 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 5.44E-10 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 4.58E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 1.59E-06 NA mr1721 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 4.07E-07 3.69E-11 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 5.78E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 2.09E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 1.20E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 7.18E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 2.59E-10 6.66E-15 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 6.45E-10 1.02E-18 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 9.20E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 2.58E-08 3.80E-12 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001428880 NA 6.22E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251