\
| Variant ID: vg1001428076 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1428076 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 116. )
TAGTCTTTTGAGTTGTGTAGGCTTAGGATCTAAAGTTGTGATTCTGGTTGGGTCTGTGGTAGAGCAGGTCCAATGTAACCTGAGTGACCTACGATTGGTG[G/A,T]
GCTGAACTGTGCACTCTAACAATTACGCTGACTATACTGATTATGCTGTTAATTATATACCGAGCTCGAGCGAACAGCCTGTGAGCTTTTATACTAGTTA
TAACTAGTATAAAAGCTCACAGGCTGTTCGCTCGAGCTCGGTATATAATTAACAGCATAATCAGTATAGTCAGCGTAATTGTTAGAGTGCACAGTTCAGC[C/T,A]
CACCAATCGTAGGTCACTCAGGTTACATTGGACCTGCTCTACCACAGACCCAACCAGAATCACAACTTTAGATCCTAAGCCTACACAACTCAAAAGACTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 9.70% | 0.04% | 0.00% | T: 0.02% |
| All Indica | 2759 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.00% | 4.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 44.20% | 55.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 0.00% | T: 1.04% |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001428076 | G -> T | LOC_Os10g03360.1 | upstream_gene_variant ; 3066.0bp to feature; MODIFIER | silent_mutation | Average:53.988; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001428076 | G -> T | LOC_Os10g03350.1 | downstream_gene_variant ; 4303.0bp to feature; MODIFIER | silent_mutation | Average:53.988; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001428076 | G -> T | LOC_Os10g03350-LOC_Os10g03360 | intergenic_region ; MODIFIER | silent_mutation | Average:53.988; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001428076 | G -> A | LOC_Os10g03360.1 | upstream_gene_variant ; 3066.0bp to feature; MODIFIER | silent_mutation | Average:53.988; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001428076 | G -> A | LOC_Os10g03350.1 | downstream_gene_variant ; 4303.0bp to feature; MODIFIER | silent_mutation | Average:53.988; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001428076 | G -> A | LOC_Os10g03350-LOC_Os10g03360 | intergenic_region ; MODIFIER | silent_mutation | Average:53.988; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001428076 | 2.13E-11 | NA | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001428076 | 6.00E-11 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001428076 | 4.55E-07 | NA | mr1588 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001428076 | 2.70E-12 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001428076 | 3.17E-12 | NA | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |