\
| Variant ID: vg1001426279 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 1426279 |
| Reference Allele: TG | Alternative Allele: GG,AG,T |
| Primary Allele: GG | Secondary Allele: TG |
Inferred Ancestral Allele: Not determined.
ATCCAACCGTACCCGTCTATTTTCACCCCTAGGTTCGACTAGATAGAGCGGATAGCCTTTTATTAATTATATAGTTGTTGGTTTTTTAAAGAACCGTATA[TG/GG,AG,T]
TATCTTTTTTTAATAAAAATACAAATAGTATAGGTACCAGTTTTTATCTAGAAGCGATACCTATAAGTTCTTGAAAGTGTCAGTTTTTTTTTCTTCCCAT
ATGGGAAGAAAAAAAAACTGACACTTTCAAGAACTTATAGGTATCGCTTCTAGATAAAAACTGGTACCTATACTATTTGTATTTTTATTAAAAAAAGATA[CA/CC,CT,A]
TATACGGTTCTTTAAAAAACCAACAACTATATAATTAATAAAAGGCTATCCGCTCTATCTAGTCGAACCTAGGGGTGAAAATAGACGGGTACGGTTGGAT
| Populations | Population Size | Frequency of GG(primary allele) | Frequency of TG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 44.50% | 0.44% | 0.00% | T: 1.78%; AG: 0.95% |
| All Indica | 2759 | 53.90% | 44.30% | 0.65% | 0.00% | AG: 1.05%; T: 0.04% |
| All Japonica | 1512 | 56.60% | 43.20% | 0.07% | 0.00% | AG: 0.13% |
| Aus | 269 | 0.40% | 66.50% | 0.74% | 0.00% | T: 30.11%; AG: 2.23% |
| Indica I | 595 | 58.00% | 41.50% | 0.34% | 0.00% | AG: 0.17% |
| Indica II | 465 | 62.80% | 35.90% | 1.08% | 0.00% | AG: 0.22% |
| Indica III | 913 | 45.10% | 51.70% | 0.55% | 0.00% | AG: 2.63% |
| Indica Intermediate | 786 | 55.90% | 42.90% | 0.76% | 0.00% | AG: 0.38%; T: 0.13% |
| Temperate Japonica | 767 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 84.70% | 15.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 13.70% | 0.41% | 0.00% | AG: 0.83% |
| VI/Aromatic | 96 | 83.30% | 9.40% | 0.00% | 0.00% | AG: 7.29% |
| Intermediate | 90 | 52.20% | 44.40% | 0.00% | 0.00% | T: 2.22%; AG: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001426279 | TG -> GG | LOC_Os10g03360.1 | upstream_gene_variant ; 4863.0bp to feature; MODIFIER | silent_mutation | Average:65.175; most accessible tissue: Callus, score: 79.538 | N | N | N | N |
| vg1001426279 | TG -> GG | LOC_Os10g03350.1 | downstream_gene_variant ; 2506.0bp to feature; MODIFIER | silent_mutation | Average:65.175; most accessible tissue: Callus, score: 79.538 | N | N | N | N |
| vg1001426279 | TG -> GG | LOC_Os10g03350-LOC_Os10g03360 | intergenic_region ; MODIFIER | silent_mutation | Average:65.175; most accessible tissue: Callus, score: 79.538 | N | N | N | N |
| vg1001426279 | TG -> AG | LOC_Os10g03360.1 | upstream_gene_variant ; 4863.0bp to feature; MODIFIER | silent_mutation | Average:65.175; most accessible tissue: Callus, score: 79.538 | N | N | N | N |
| vg1001426279 | TG -> AG | LOC_Os10g03350.1 | downstream_gene_variant ; 2506.0bp to feature; MODIFIER | silent_mutation | Average:65.175; most accessible tissue: Callus, score: 79.538 | N | N | N | N |
| vg1001426279 | TG -> AG | LOC_Os10g03350-LOC_Os10g03360 | intergenic_region ; MODIFIER | silent_mutation | Average:65.175; most accessible tissue: Callus, score: 79.538 | N | N | N | N |
| vg1001426279 | TG -> T | LOC_Os10g03360.1 | upstream_gene_variant ; 4862.0bp to feature; MODIFIER | silent_mutation | Average:65.175; most accessible tissue: Callus, score: 79.538 | N | N | N | N |
| vg1001426279 | TG -> T | LOC_Os10g03350.1 | downstream_gene_variant ; 2507.0bp to feature; MODIFIER | silent_mutation | Average:65.175; most accessible tissue: Callus, score: 79.538 | N | N | N | N |
| vg1001426279 | TG -> T | LOC_Os10g03350-LOC_Os10g03360 | intergenic_region ; MODIFIER | silent_mutation | Average:65.175; most accessible tissue: Callus, score: 79.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001426279 | 3.89E-09 | 1.61E-11 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | NA | 1.93E-12 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | 4.12E-07 | 2.40E-08 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | NA | 2.27E-08 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | NA | 1.58E-08 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | NA | 1.46E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | NA | 3.01E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | NA | 3.09E-07 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | NA | 1.08E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | NA | 3.93E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | NA | 3.68E-08 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | 5.09E-09 | 1.02E-11 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | 3.10E-10 | 6.67E-17 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | 1.80E-06 | NA | mr1721_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001426279 | 2.02E-07 | 5.07E-10 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |