\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001426279:

Variant ID: vg1001426279 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 1426279
Reference Allele: TGAlternative Allele: GG,AG,T
Primary Allele: GGSecondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCAACCGTACCCGTCTATTTTCACCCCTAGGTTCGACTAGATAGAGCGGATAGCCTTTTATTAATTATATAGTTGTTGGTTTTTTAAAGAACCGTATA[TG/GG,AG,T]
TATCTTTTTTTAATAAAAATACAAATAGTATAGGTACCAGTTTTTATCTAGAAGCGATACCTATAAGTTCTTGAAAGTGTCAGTTTTTTTTTCTTCCCAT

Reverse complement sequence

ATGGGAAGAAAAAAAAACTGACACTTTCAAGAACTTATAGGTATCGCTTCTAGATAAAAACTGGTACCTATACTATTTGTATTTTTATTAAAAAAAGATA[CA/CC,CT,A]
TATACGGTTCTTTAAAAAACCAACAACTATATAATTAATAAAAGGCTATCCGCTCTATCTAGTCGAACCTAGGGGTGAAAATAGACGGGTACGGTTGGAT

Allele Frequencies:

Populations Population SizeFrequency of GG(primary allele) Frequency of TG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 44.50% 0.44% 0.00% T: 1.78%; AG: 0.95%
All Indica  2759 53.90% 44.30% 0.65% 0.00% AG: 1.05%; T: 0.04%
All Japonica  1512 56.60% 43.20% 0.07% 0.00% AG: 0.13%
Aus  269 0.40% 66.50% 0.74% 0.00% T: 30.11%; AG: 2.23%
Indica I  595 58.00% 41.50% 0.34% 0.00% AG: 0.17%
Indica II  465 62.80% 35.90% 1.08% 0.00% AG: 0.22%
Indica III  913 45.10% 51.70% 0.55% 0.00% AG: 2.63%
Indica Intermediate  786 55.90% 42.90% 0.76% 0.00% AG: 0.38%; T: 0.13%
Temperate Japonica  767 29.20% 70.80% 0.00% 0.00% NA
Tropical Japonica  504 84.70% 15.30% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 13.70% 0.41% 0.00% AG: 0.83%
VI/Aromatic  96 83.30% 9.40% 0.00% 0.00% AG: 7.29%
Intermediate  90 52.20% 44.40% 0.00% 0.00% T: 2.22%; AG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001426279 TG -> GG LOC_Os10g03360.1 upstream_gene_variant ; 4863.0bp to feature; MODIFIER silent_mutation Average:65.175; most accessible tissue: Callus, score: 79.538 N N N N
vg1001426279 TG -> GG LOC_Os10g03350.1 downstream_gene_variant ; 2506.0bp to feature; MODIFIER silent_mutation Average:65.175; most accessible tissue: Callus, score: 79.538 N N N N
vg1001426279 TG -> GG LOC_Os10g03350-LOC_Os10g03360 intergenic_region ; MODIFIER silent_mutation Average:65.175; most accessible tissue: Callus, score: 79.538 N N N N
vg1001426279 TG -> AG LOC_Os10g03360.1 upstream_gene_variant ; 4863.0bp to feature; MODIFIER silent_mutation Average:65.175; most accessible tissue: Callus, score: 79.538 N N N N
vg1001426279 TG -> AG LOC_Os10g03350.1 downstream_gene_variant ; 2506.0bp to feature; MODIFIER silent_mutation Average:65.175; most accessible tissue: Callus, score: 79.538 N N N N
vg1001426279 TG -> AG LOC_Os10g03350-LOC_Os10g03360 intergenic_region ; MODIFIER silent_mutation Average:65.175; most accessible tissue: Callus, score: 79.538 N N N N
vg1001426279 TG -> T LOC_Os10g03360.1 upstream_gene_variant ; 4862.0bp to feature; MODIFIER silent_mutation Average:65.175; most accessible tissue: Callus, score: 79.538 N N N N
vg1001426279 TG -> T LOC_Os10g03350.1 downstream_gene_variant ; 2507.0bp to feature; MODIFIER silent_mutation Average:65.175; most accessible tissue: Callus, score: 79.538 N N N N
vg1001426279 TG -> T LOC_Os10g03350-LOC_Os10g03360 intergenic_region ; MODIFIER silent_mutation Average:65.175; most accessible tissue: Callus, score: 79.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001426279 3.89E-09 1.61E-11 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 NA 1.93E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 4.12E-07 2.40E-08 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 NA 2.27E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 NA 1.58E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 NA 1.46E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 NA 3.01E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 NA 3.09E-07 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 NA 1.08E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 NA 3.93E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 NA 3.68E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 5.09E-09 1.02E-11 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 3.10E-10 6.67E-17 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 1.80E-06 NA mr1721_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001426279 2.02E-07 5.07E-10 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251