\
| Variant ID: vg1001395986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1395986 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGTTTGTGGGGAGTGCTTCTCGCACGACTGCTCGTCCTCGTCCACCATGTCTACGCCTGGAGCCGGAGCTGCCGCCGGCGCCGCCGCCGCTGCTGCTGCT[A/G]
GAGGAGATGGCGCGCCTGGAGCTGGAGCCGGAGATGGCACGCCTGGAGCCGGTGCCGCGAACGTCAACACCAAGGGAGGCAATTCTGCCTCACAATCCAG
CTGGATTGTGAGGCAGAATTGCCTCCCTTGGTGTTGACGTTCGCGGCACCGGCTCCAGGCGTGCCATCTCCGGCTCCAGCTCCAGGCGCGCCATCTCCTC[T/C]
AGCAGCAGCAGCGGCGGCGGCGCCGGCGGCAGCTCCGGCTCCAGGCGTAGACATGGTGGACGAGGACGAGCAGTCGTGCGAGAAGCACTCCCCACAAACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.30% | 2.40% | 4.80% | 7.58% | NA |
| All Indica | 2759 | 95.80% | 0.80% | 1.01% | 2.36% | NA |
| All Japonica | 1512 | 69.40% | 4.20% | 9.85% | 16.53% | NA |
| Aus | 269 | 97.40% | 1.50% | 1.12% | 0.00% | NA |
| Indica I | 595 | 98.20% | 0.20% | 0.67% | 1.01% | NA |
| Indica II | 465 | 96.10% | 0.90% | 0.65% | 2.37% | NA |
| Indica III | 913 | 95.80% | 0.50% | 0.88% | 2.74% | NA |
| Indica Intermediate | 786 | 93.90% | 1.50% | 1.65% | 2.93% | NA |
| Temperate Japonica | 767 | 74.80% | 2.10% | 7.30% | 15.78% | NA |
| Tropical Japonica | 504 | 78.40% | 4.40% | 7.74% | 9.52% | NA |
| Japonica Intermediate | 241 | 33.20% | 10.80% | 22.41% | 33.61% | NA |
| VI/Aromatic | 96 | 9.40% | 13.50% | 41.67% | 35.42% | NA |
| Intermediate | 90 | 72.20% | 10.00% | 7.78% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001395986 | A -> G | LOC_Os10g03300.1 | missense_variant ; p.Arg19Gly; MODERATE | nonsynonymous_codon ; R19G | Average:54.933; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | unknown | unknown | TOLERATED | 1.00 |
| vg1001395986 | A -> DEL | LOC_Os10g03300.1 | N | frameshift_variant | Average:54.933; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001395986 | 3.66E-06 | 7.19E-07 | mr1304 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395986 | 6.83E-11 | 1.28E-41 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395986 | 3.40E-09 | 3.80E-30 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395986 | NA | 5.20E-07 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395986 | 5.19E-06 | 5.55E-07 | mr1685 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395986 | 5.85E-15 | 2.73E-52 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395986 | 3.23E-06 | NA | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395986 | 2.91E-07 | NA | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |