\
| Variant ID: vg1001395945 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1395945 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )
ACACCTTCGCCTGAGATCTGCACCGGGTAGGCGGGTGATCAGGTTTGTGGGGAGTGCTTCTCGCACGACTGCTCGTCCTCGTCCACCATGTCTACGCCTG[G/T]
AGCCGGAGCTGCCGCCGGCGCCGCCGCCGCTGCTGCTGCTAGAGGAGATGGCGCGCCTGGAGCTGGAGCCGGAGATGGCACGCCTGGAGCCGGTGCCGCG
CGCGGCACCGGCTCCAGGCGTGCCATCTCCGGCTCCAGCTCCAGGCGCGCCATCTCCTCTAGCAGCAGCAGCGGCGGCGGCGCCGGCGGCAGCTCCGGCT[C/A]
CAGGCGTAGACATGGTGGACGAGGACGAGCAGTCGTGCGAGAAGCACTCCCCACAAACCTGATCACCCGCCTACCCGGTGCAGATCTCAGGCGAAGGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.70% | 13.10% | 1.14% | 1.04% | NA |
| All Indica | 2759 | 74.60% | 22.20% | 1.49% | 1.67% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 97.40% | 0.00% | 2.60% | 0.00% | NA |
| Indica I | 595 | 61.20% | 37.60% | 0.50% | 0.67% | NA |
| Indica II | 465 | 72.30% | 27.10% | 0.43% | 0.22% | NA |
| Indica III | 913 | 81.60% | 12.40% | 3.18% | 2.85% | NA |
| Indica Intermediate | 786 | 78.10% | 19.10% | 0.89% | 1.91% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 1.00% | 4.17% | 3.12% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001395945 | G -> T | LOC_Os10g03300.1 | missense_variant ; p.Gly5Val; MODERATE | nonsynonymous_codon ; G5V | Average:55.126; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | unknown | unknown | DELETERIOUS | 0.00 |
| vg1001395945 | G -> DEL | LOC_Os10g03300.1 | N | frameshift_variant | Average:55.126; most accessible tissue: Zhenshan97 flag leaf, score: 79.481 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001395945 | 2.35E-09 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395945 | 9.35E-10 | 3.56E-14 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395945 | 3.75E-07 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395945 | 1.27E-07 | 4.88E-10 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395945 | 6.48E-09 | NA | mr1721 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395945 | 3.11E-08 | 4.94E-12 | mr1721 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395945 | 1.41E-07 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395945 | 3.47E-08 | 1.95E-13 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395945 | 7.83E-12 | NA | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395945 | 1.28E-11 | 1.49E-14 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |