\
| Variant ID: vg1001395791 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1395791 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 61. )
TTCTTTTGCAACCACGAACCCACGTTCTCACGACTGTCTCCGCAACGGCGCGTCCACGATCCCACGTTCCCATGACTGCCTATGCTGCTCTCGCCTTCTC[G/T,A]
CTTCTGATCGCTTGCGCGCACGAGAGATCAGAAGGAGCAGGGCCTCCAGAACCACACCTTCGCCTGAGATCTGCACCGGGTAGGCGGGTGATCAGGTTTG
CAAACCTGATCACCCGCCTACCCGGTGCAGATCTCAGGCGAAGGTGTGGTTCTGGAGGCCCTGCTCCTTCTGATCTCTCGTGCGCGCAAGCGATCAGAAG[C/A,T]
GAGAAGGCGAGAGCAGCATAGGCAGTCATGGGAACGTGGGATCGTGGACGCGCCGTTGCGGAGACAGTCGTGAGAACGTGGGTTCGTGGTTGCAAAAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.00% | 23.30% | 0.40% | 2.29% | A: 0.02% |
| All Indica | 2759 | 68.50% | 27.70% | 0.47% | 3.33% | NA |
| All Japonica | 1512 | 94.80% | 5.00% | 0.00% | 0.13% | A: 0.07% |
| Aus | 269 | 5.60% | 90.00% | 1.86% | 2.60% | NA |
| Indica I | 595 | 60.00% | 37.80% | 0.84% | 1.34% | NA |
| Indica II | 465 | 71.40% | 27.70% | 0.22% | 0.65% | NA |
| Indica III | 913 | 72.40% | 20.50% | 0.77% | 6.35% | NA |
| Indica Intermediate | 786 | 68.80% | 28.20% | 0.00% | 2.93% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.10% | 0.00% | 0.83% | A: 0.41% |
| VI/Aromatic | 96 | 87.50% | 5.20% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001395791 | G -> T | LOC_Os10g03300.1 | upstream_gene_variant ; 141.0bp to feature; MODIFIER | silent_mutation | Average:59.798; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1001395791 | G -> T | LOC_Os10g03290.1 | downstream_gene_variant ; 3962.0bp to feature; MODIFIER | silent_mutation | Average:59.798; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1001395791 | G -> T | LOC_Os10g03290-LOC_Os10g03300 | intergenic_region ; MODIFIER | silent_mutation | Average:59.798; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1001395791 | G -> A | LOC_Os10g03300.1 | upstream_gene_variant ; 141.0bp to feature; MODIFIER | silent_mutation | Average:59.798; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1001395791 | G -> A | LOC_Os10g03290.1 | downstream_gene_variant ; 3962.0bp to feature; MODIFIER | silent_mutation | Average:59.798; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1001395791 | G -> A | LOC_Os10g03290-LOC_Os10g03300 | intergenic_region ; MODIFIER | silent_mutation | Average:59.798; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1001395791 | G -> DEL | N | N | silent_mutation | Average:59.798; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001395791 | 5.78E-10 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395791 | 2.55E-12 | 1.04E-15 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395791 | 3.52E-08 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395791 | 8.15E-10 | 2.45E-11 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395791 | 6.69E-08 | NA | mr1721 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395791 | 2.42E-07 | 9.16E-11 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395791 | 2.39E-09 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395791 | 2.84E-11 | 1.35E-15 | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395791 | 2.10E-10 | NA | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001395791 | 6.60E-10 | 7.80E-13 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |