\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001393119:

Variant ID: vg1001393119 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1393119
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, G: 0.11, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CACAAACTAGAATAAGAGGGAAAGCAAAGCAAGTAGAGAGTGAGTAAACCGGTCTTAATGAGATAAGAATAATGCATTGATAGAGGATGAGAGGAGTCCG[C/G]
TAGGCCTTACTATTTGTCACCATAGGGCATATTGAGTAAAGGCCAGTGCAAGTGGATTGTACAGTGACCAAACAAATTCGATGCTACAAATGCAAAAATC

Reverse complement sequence

GATTTTTGCATTTGTAGCATCGAATTTGTTTGGTCACTGTACAATCCACTTGCACTGGCCTTTACTCAATATGCCCTATGGTGACAAATAGTAAGGCCTA[G/C]
CGGACTCCTCTCATCCTCTATCAATGCATTATTCTTATCTCATTAAGACCGGTTTACTCACTCTCTACTTGCTTTGCTTTCCCTCTTATTCTAGTTTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 32.80% 5.33% 11.53% NA
All Indica  2759 72.40% 23.10% 1.05% 3.41% NA
All Japonica  1512 6.50% 54.80% 12.04% 26.72% NA
Aus  269 93.70% 4.10% 2.23% 0.00% NA
Indica I  595 96.00% 2.50% 0.34% 1.18% NA
Indica II  465 60.90% 36.10% 1.08% 1.94% NA
Indica III  913 61.70% 32.60% 0.99% 4.71% NA
Indica Intermediate  786 73.90% 20.00% 1.65% 4.45% NA
Temperate Japonica  767 0.80% 79.90% 8.60% 10.69% NA
Tropical Japonica  504 16.50% 24.40% 12.50% 46.63% NA
Japonica Intermediate  241 3.70% 38.20% 21.99% 36.10% NA
VI/Aromatic  96 5.20% 34.40% 25.00% 35.42% NA
Intermediate  90 31.10% 42.20% 12.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001393119 C -> G LOC_Os10g03300.1 upstream_gene_variant ; 2813.0bp to feature; MODIFIER silent_mutation Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg1001393119 C -> G LOC_Os10g03280.1 downstream_gene_variant ; 3933.0bp to feature; MODIFIER silent_mutation Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg1001393119 C -> G LOC_Os10g03290.1 downstream_gene_variant ; 1290.0bp to feature; MODIFIER silent_mutation Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg1001393119 C -> G LOC_Os10g03290-LOC_Os10g03300 intergenic_region ; MODIFIER silent_mutation Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N
vg1001393119 C -> DEL N N silent_mutation Average:60.094; most accessible tissue: Minghui63 young leaf, score: 89.109 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1001393119 C G 0.01 -0.01 -0.01 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001393119 NA 6.68E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 1.61E-14 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 4.27E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 8.99E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 1.74E-30 mr1495 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 1.49E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 6.09E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 2.11E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 2.73E-27 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 6.74E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 8.80E-28 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 4.40E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 2.70E-30 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 1.91E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 8.06E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001393119 NA 1.15E-26 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251