\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001390120:

Variant ID: vg1001390120 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1390120
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCGCCTTCCGTCGAGCCACGCTTCATCAACATAATTTCTCCGTCAAGCTATTTGTCATCGACAACACAACGGCGCCGTAGTGTTGTGCAGATATTATG[C/T]
ATAGCTCGGCATTATCTCTTAGAGGGAGCAAATATACACCGTAGTGTTGTGCAGTTGGGCAGCTTGGACGGTAAAACAGTAAAGTGGAGTACTAATGAAT

Reverse complement sequence

ATTCATTAGTACTCCACTTTACTGTTTTACCGTCCAAGCTGCCCAACTGCACAACACTACGGTGTATATTTGCTCCCTCTAAGAGATAATGCCGAGCTAT[G/A]
CATAATATCTGCACAACACTACGGCGCCGTTGTGTTGTCGATGACAAATAGCTTGACGGAGAAATTATGTTGATGAAGCGTGGCTCGACGGAAGGCGAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 12.90% 0.32% 0.00% NA
All Indica  2759 77.70% 21.70% 0.54% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 61.80% 38.00% 0.17% 0.00% NA
Indica II  465 73.10% 26.00% 0.86% 0.00% NA
Indica III  913 87.40% 12.40% 0.22% 0.00% NA
Indica Intermediate  786 81.20% 17.80% 1.02% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001390120 C -> T LOC_Os10g03270.1 upstream_gene_variant ; 4545.0bp to feature; MODIFIER silent_mutation Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg1001390120 C -> T LOC_Os10g03290.1 upstream_gene_variant ; 693.0bp to feature; MODIFIER silent_mutation Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg1001390120 C -> T LOC_Os10g03280.1 downstream_gene_variant ; 934.0bp to feature; MODIFIER silent_mutation Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg1001390120 C -> T LOC_Os10g03280-LOC_Os10g03290 intergenic_region ; MODIFIER silent_mutation Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001390120 1.81E-09 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120 5.68E-10 1.27E-13 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120 1.24E-07 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120 4.76E-08 3.01E-10 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120 3.97E-07 NA mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120 1.23E-06 1.88E-10 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120 7.91E-08 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120 1.12E-08 1.11E-12 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120 1.48E-11 NA mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120 4.87E-11 2.39E-15 mr1721_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251