\
| Variant ID: vg1001390120 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1390120 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )
ATTCGCCTTCCGTCGAGCCACGCTTCATCAACATAATTTCTCCGTCAAGCTATTTGTCATCGACAACACAACGGCGCCGTAGTGTTGTGCAGATATTATG[C/T]
ATAGCTCGGCATTATCTCTTAGAGGGAGCAAATATACACCGTAGTGTTGTGCAGTTGGGCAGCTTGGACGGTAAAACAGTAAAGTGGAGTACTAATGAAT
ATTCATTAGTACTCCACTTTACTGTTTTACCGTCCAAGCTGCCCAACTGCACAACACTACGGTGTATATTTGCTCCCTCTAAGAGATAATGCCGAGCTAT[G/A]
CATAATATCTGCACAACACTACGGCGCCGTTGTGTTGTCGATGACAAATAGCTTGACGGAGAAATTATGTTGATGAAGCGTGGCTCGACGGAAGGCGAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.80% | 12.90% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 77.70% | 21.70% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 61.80% | 38.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 73.10% | 26.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 87.40% | 12.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 81.20% | 17.80% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001390120 | C -> T | LOC_Os10g03270.1 | upstream_gene_variant ; 4545.0bp to feature; MODIFIER | silent_mutation | Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| vg1001390120 | C -> T | LOC_Os10g03290.1 | upstream_gene_variant ; 693.0bp to feature; MODIFIER | silent_mutation | Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| vg1001390120 | C -> T | LOC_Os10g03280.1 | downstream_gene_variant ; 934.0bp to feature; MODIFIER | silent_mutation | Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| vg1001390120 | C -> T | LOC_Os10g03280-LOC_Os10g03290 | intergenic_region ; MODIFIER | silent_mutation | Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001390120 | 1.81E-09 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001390120 | 5.68E-10 | 1.27E-13 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001390120 | 1.24E-07 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001390120 | 4.76E-08 | 3.01E-10 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001390120 | 3.97E-07 | NA | mr1721 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001390120 | 1.23E-06 | 1.88E-10 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001390120 | 7.91E-08 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001390120 | 1.12E-08 | 1.11E-12 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001390120 | 1.48E-11 | NA | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001390120 | 4.87E-11 | 2.39E-15 | mr1721_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |