Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001390120:

Variant ID: vg1001390120 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1390120
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCGCCTTCCGTCGAGCCACGCTTCATCAACATAATTTCTCCGTCAAGCTATTTGTCATCGACAACACAACGGCGCCGTAGTGTTGTGCAGATATTATG[C/T]
ATAGCTCGGCATTATCTCTTAGAGGGAGCAAATATACACCGTAGTGTTGTGCAGTTGGGCAGCTTGGACGGTAAAACAGTAAAGTGGAGTACTAATGAAT

Reverse complement sequence

ATTCATTAGTACTCCACTTTACTGTTTTACCGTCCAAGCTGCCCAACTGCACAACACTACGGTGTATATTTGCTCCCTCTAAGAGATAATGCCGAGCTAT[G/A]
CATAATATCTGCACAACACTACGGCGCCGTTGTGTTGTCGATGACAAATAGCTTGACGGAGAAATTATGTTGATGAAGCGTGGCTCGACGGAAGGCGAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	12.90%	0.32%	0.00%	NA
All Indica	2759	77.70%	21.70%	0.54%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	61.80%	38.00%	0.17%	0.00%	NA
Indica II	465	73.10%	26.00%	0.86%	0.00%	NA
Indica III	913	87.40%	12.40%	0.22%	0.00%	NA
Indica Intermediate	786	81.20%	17.80%	1.02%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001390120	C -> T	LOC_Os10g03270.1	upstream_gene_variant ; 4545.0bp to feature; MODIFIER	silent_mutation	Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg1001390120	C -> T	LOC_Os10g03290.1	upstream_gene_variant ; 693.0bp to feature; MODIFIER	silent_mutation	Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg1001390120	C -> T	LOC_Os10g03280.1	downstream_gene_variant ; 934.0bp to feature; MODIFIER	silent_mutation	Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg1001390120	C -> T	LOC_Os10g03280-LOC_Os10g03290	intergenic_region ; MODIFIER	silent_mutation	Average:43.027; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001390120	1.81E-09	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120	5.68E-10	1.27E-13	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120	1.24E-07	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120	4.76E-08	3.01E-10	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120	3.97E-07	NA	mr1721	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120	1.23E-06	1.88E-10	mr1721	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120	7.91E-08	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120	1.12E-08	1.11E-12	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120	1.48E-11	NA	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001390120	4.87E-11	2.39E-15	mr1721_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251