\
| Variant ID: vg1001388777 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1388777 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )
CACAAATATTTTAGTAGGAGCTCAATTCTGATTAGGCAAAAGGAGATTAAAAACTTCTCGGTGACTTGCCGGCGGCTCGCAAACAGGCGCGCCGTGCAGT[G/A]
GAGGTTAAACATTCCCCCGTCGAGCTGATGTCGCAGGCGGAGATGATCGTGCTAGGCGGTGAGTACGATGAATAATTTCCTCCGATCCTGTTGGTAAATC
GATTTACCAACAGGATCGGAGGAAATTATTCATCGTACTCACCGCCTAGCACGATCATCTCCGCCTGCGACATCAGCTCGACGGGGGAATGTTTAACCTC[C/T]
ACTGCACGGCGCGCCTGTTTGCGAGCCGCCGGCAAGTCACCGAGAAGTTTTTAATCTCCTTTTGCCTAATCAGAATTGAGCTCCTACTAAAATATTTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 13.20% | 0.51% | 1.90% | NA |
| All Indica | 2759 | 74.10% | 22.40% | 0.62% | 2.94% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.00% | 0.13% | NA |
| Aus | 269 | 97.80% | 0.00% | 2.23% | 0.00% | NA |
| Indica I | 595 | 60.50% | 38.20% | 0.34% | 1.01% | NA |
| Indica II | 465 | 72.00% | 27.30% | 0.00% | 0.65% | NA |
| Indica III | 913 | 80.80% | 12.50% | 1.42% | 5.26% | NA |
| Indica Intermediate | 786 | 77.70% | 19.00% | 0.25% | 3.05% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001388777 | G -> A | LOC_Os10g03270.1 | upstream_gene_variant ; 3202.0bp to feature; MODIFIER | silent_mutation | Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| vg1001388777 | G -> A | LOC_Os10g03280.1 | upstream_gene_variant ; 28.0bp to feature; MODIFIER | silent_mutation | Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| vg1001388777 | G -> A | LOC_Os10g03290.1 | upstream_gene_variant ; 2036.0bp to feature; MODIFIER | silent_mutation | Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| vg1001388777 | G -> A | LOC_Os10g03270-LOC_Os10g03280 | intergenic_region ; MODIFIER | silent_mutation | Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| vg1001388777 | G -> DEL | N | N | silent_mutation | Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001388777 | 3.46E-10 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388777 | 7.11E-11 | 1.36E-14 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388777 | 3.86E-08 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388777 | 1.64E-08 | 1.24E-10 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388777 | 7.28E-09 | NA | mr1721 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388777 | 3.70E-08 | 4.46E-12 | mr1721 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388777 | 1.08E-08 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388777 | 9.79E-10 | 5.23E-14 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388777 | 1.74E-11 | NA | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388777 | 3.83E-11 | 1.49E-14 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |