\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001388777:

Variant ID: vg1001388777 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1388777
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CACAAATATTTTAGTAGGAGCTCAATTCTGATTAGGCAAAAGGAGATTAAAAACTTCTCGGTGACTTGCCGGCGGCTCGCAAACAGGCGCGCCGTGCAGT[G/A]
GAGGTTAAACATTCCCCCGTCGAGCTGATGTCGCAGGCGGAGATGATCGTGCTAGGCGGTGAGTACGATGAATAATTTCCTCCGATCCTGTTGGTAAATC

Reverse complement sequence

GATTTACCAACAGGATCGGAGGAAATTATTCATCGTACTCACCGCCTAGCACGATCATCTCCGCCTGCGACATCAGCTCGACGGGGGAATGTTTAACCTC[C/T]
ACTGCACGGCGCGCCTGTTTGCGAGCCGCCGGCAAGTCACCGAGAAGTTTTTAATCTCCTTTTGCCTAATCAGAATTGAGCTCCTACTAAAATATTTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 13.20% 0.51% 1.90% NA
All Indica  2759 74.10% 22.40% 0.62% 2.94% NA
All Japonica  1512 99.70% 0.20% 0.00% 0.13% NA
Aus  269 97.80% 0.00% 2.23% 0.00% NA
Indica I  595 60.50% 38.20% 0.34% 1.01% NA
Indica II  465 72.00% 27.30% 0.00% 0.65% NA
Indica III  913 80.80% 12.50% 1.42% 5.26% NA
Indica Intermediate  786 77.70% 19.00% 0.25% 3.05% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.00% 0.83% NA
VI/Aromatic  96 92.70% 1.00% 0.00% 6.25% NA
Intermediate  90 93.30% 4.40% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001388777 G -> A LOC_Os10g03270.1 upstream_gene_variant ; 3202.0bp to feature; MODIFIER silent_mutation Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg1001388777 G -> A LOC_Os10g03280.1 upstream_gene_variant ; 28.0bp to feature; MODIFIER silent_mutation Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg1001388777 G -> A LOC_Os10g03290.1 upstream_gene_variant ; 2036.0bp to feature; MODIFIER silent_mutation Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg1001388777 G -> A LOC_Os10g03270-LOC_Os10g03280 intergenic_region ; MODIFIER silent_mutation Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg1001388777 G -> DEL N N silent_mutation Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001388777 3.46E-10 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777 7.11E-11 1.36E-14 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777 3.86E-08 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777 1.64E-08 1.24E-10 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777 7.28E-09 NA mr1721 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777 3.70E-08 4.46E-12 mr1721 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777 1.08E-08 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777 9.79E-10 5.23E-14 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777 1.74E-11 NA mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777 3.83E-11 1.49E-14 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251