Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001388777:

Variant ID: vg1001388777 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1388777
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CACAAATATTTTAGTAGGAGCTCAATTCTGATTAGGCAAAAGGAGATTAAAAACTTCTCGGTGACTTGCCGGCGGCTCGCAAACAGGCGCGCCGTGCAGT[G/A]
GAGGTTAAACATTCCCCCGTCGAGCTGATGTCGCAGGCGGAGATGATCGTGCTAGGCGGTGAGTACGATGAATAATTTCCTCCGATCCTGTTGGTAAATC

Reverse complement sequence

GATTTACCAACAGGATCGGAGGAAATTATTCATCGTACTCACCGCCTAGCACGATCATCTCCGCCTGCGACATCAGCTCGACGGGGGAATGTTTAACCTC[C/T]
ACTGCACGGCGCGCCTGTTTGCGAGCCGCCGGCAAGTCACCGAGAAGTTTTTAATCTCCTTTTGCCTAATCAGAATTGAGCTCCTACTAAAATATTTGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	13.20%	0.51%	1.90%	NA
All Indica	2759	74.10%	22.40%	0.62%	2.94%	NA
All Japonica	1512	99.70%	0.20%	0.00%	0.13%	NA
Aus	269	97.80%	0.00%	2.23%	0.00%	NA
Indica I	595	60.50%	38.20%	0.34%	1.01%	NA
Indica II	465	72.00%	27.30%	0.00%	0.65%	NA
Indica III	913	80.80%	12.50%	1.42%	5.26%	NA
Indica Intermediate	786	77.70%	19.00%	0.25%	3.05%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.80%	0.00%	0.83%	NA
VI/Aromatic	96	92.70%	1.00%	0.00%	6.25%	NA
Intermediate	90	93.30%	4.40%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001388777	G -> A	LOC_Os10g03270.1	upstream_gene_variant ; 3202.0bp to feature; MODIFIER	silent_mutation	Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143	N	N	N	N
vg1001388777	G -> A	LOC_Os10g03280.1	upstream_gene_variant ; 28.0bp to feature; MODIFIER	silent_mutation	Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143	N	N	N	N
vg1001388777	G -> A	LOC_Os10g03290.1	upstream_gene_variant ; 2036.0bp to feature; MODIFIER	silent_mutation	Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143	N	N	N	N
vg1001388777	G -> A	LOC_Os10g03270-LOC_Os10g03280	intergenic_region ; MODIFIER	silent_mutation	Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143	N	N	N	N
vg1001388777	G -> DEL	N	N	silent_mutation	Average:55.236; most accessible tissue: Zhenshan97 flag leaf, score: 75.143	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001388777	3.46E-10	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777	7.11E-11	1.36E-14	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777	3.86E-08	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777	1.64E-08	1.24E-10	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777	7.28E-09	NA	mr1721	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777	3.70E-08	4.46E-12	mr1721	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777	1.08E-08	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777	9.79E-10	5.23E-14	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777	1.74E-11	NA	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388777	3.83E-11	1.49E-14	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251