\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001388587:

Variant ID: vg1001388587 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1388587
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCCAGCTTGATCTATCCATCCTACATCTGCCTATATAAAGCACCTTGACTCCCACTGCTCGGGGGGCTGGCAGATGCATCCATGCAGAAGCGCTAAGG[C/T]
GCTGCACATACACGCCACGCCGGCGCCGCCGACGCTATGCGCTGCGCAGAGATGCAGGCCCTGCGCCGGTGGCCGGCGGCACATGTGCCCACAAATATTT

Reverse complement sequence

AAATATTTGTGGGCACATGTGCCGCCGGCCACCGGCGCAGGGCCTGCATCTCTGCGCAGCGCATAGCGTCGGCGGCGCCGGCGTGGCGTGTATGTGCAGC[G/A]
CCTTAGCGCTTCTGCATGGATGCATCTGCCAGCCCCCCGAGCAGTGGGAGTCAAGGTGCTTTATATAGGCAGATGTAGGATGGATAGATCAAGCTGGCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 26.50% 0.68% 1.06% NA
All Indica  2759 64.70% 32.80% 1.05% 1.52% NA
All Japonica  1512 94.80% 5.10% 0.07% 0.07% NA
Aus  269 6.30% 93.70% 0.00% 0.00% NA
Indica I  595 61.00% 38.00% 0.67% 0.34% NA
Indica II  465 70.80% 28.60% 0.22% 0.43% NA
Indica III  913 63.30% 32.40% 1.97% 2.30% NA
Indica Intermediate  786 65.40% 31.70% 0.76% 2.16% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 86.30% 13.70% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.50% 0.41% 0.41% NA
VI/Aromatic  96 86.50% 5.20% 2.08% 6.25% NA
Intermediate  90 82.20% 16.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001388587 C -> T LOC_Os10g03270.1 upstream_gene_variant ; 3012.0bp to feature; MODIFIER silent_mutation Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 N N N N
vg1001388587 C -> T LOC_Os10g03280.1 upstream_gene_variant ; 218.0bp to feature; MODIFIER silent_mutation Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 N N N N
vg1001388587 C -> T LOC_Os10g03290.1 upstream_gene_variant ; 2226.0bp to feature; MODIFIER silent_mutation Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 N N N N
vg1001388587 C -> T LOC_Os10g03270-LOC_Os10g03280 intergenic_region ; MODIFIER silent_mutation Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 N N N N
vg1001388587 C -> DEL N N silent_mutation Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001388587 8.69E-11 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388587 1.61E-12 7.62E-15 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388587 3.39E-08 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388587 5.06E-09 2.28E-10 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388587 1.79E-08 NA mr1721 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388587 1.46E-07 2.53E-10 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388587 3.09E-09 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388587 2.49E-11 1.67E-14 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388587 4.36E-11 NA mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001388587 1.18E-09 3.59E-12 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251