\
| Variant ID: vg1001388587 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1388587 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 100. )
GTGCCAGCTTGATCTATCCATCCTACATCTGCCTATATAAAGCACCTTGACTCCCACTGCTCGGGGGGCTGGCAGATGCATCCATGCAGAAGCGCTAAGG[C/T]
GCTGCACATACACGCCACGCCGGCGCCGCCGACGCTATGCGCTGCGCAGAGATGCAGGCCCTGCGCCGGTGGCCGGCGGCACATGTGCCCACAAATATTT
AAATATTTGTGGGCACATGTGCCGCCGGCCACCGGCGCAGGGCCTGCATCTCTGCGCAGCGCATAGCGTCGGCGGCGCCGGCGTGGCGTGTATGTGCAGC[G/A]
CCTTAGCGCTTCTGCATGGATGCATCTGCCAGCCCCCCGAGCAGTGGGAGTCAAGGTGCTTTATATAGGCAGATGTAGGATGGATAGATCAAGCTGGCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.80% | 26.50% | 0.68% | 1.06% | NA |
| All Indica | 2759 | 64.70% | 32.80% | 1.05% | 1.52% | NA |
| All Japonica | 1512 | 94.80% | 5.10% | 0.07% | 0.07% | NA |
| Aus | 269 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 61.00% | 38.00% | 0.67% | 0.34% | NA |
| Indica II | 465 | 70.80% | 28.60% | 0.22% | 0.43% | NA |
| Indica III | 913 | 63.30% | 32.40% | 1.97% | 2.30% | NA |
| Indica Intermediate | 786 | 65.40% | 31.70% | 0.76% | 2.16% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 86.50% | 5.20% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001388587 | C -> T | LOC_Os10g03270.1 | upstream_gene_variant ; 3012.0bp to feature; MODIFIER | silent_mutation | Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 | N | N | N | N |
| vg1001388587 | C -> T | LOC_Os10g03280.1 | upstream_gene_variant ; 218.0bp to feature; MODIFIER | silent_mutation | Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 | N | N | N | N |
| vg1001388587 | C -> T | LOC_Os10g03290.1 | upstream_gene_variant ; 2226.0bp to feature; MODIFIER | silent_mutation | Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 | N | N | N | N |
| vg1001388587 | C -> T | LOC_Os10g03270-LOC_Os10g03280 | intergenic_region ; MODIFIER | silent_mutation | Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 | N | N | N | N |
| vg1001388587 | C -> DEL | N | N | silent_mutation | Average:67.11; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001388587 | 8.69E-11 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388587 | 1.61E-12 | 7.62E-15 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388587 | 3.39E-08 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388587 | 5.06E-09 | 2.28E-10 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388587 | 1.79E-08 | NA | mr1721 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388587 | 1.46E-07 | 2.53E-10 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388587 | 3.09E-09 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388587 | 2.49E-11 | 1.67E-14 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388587 | 4.36E-11 | NA | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001388587 | 1.18E-09 | 3.59E-12 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |