Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001385374:

Variant ID: vg1001385374 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1385374
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ACACCGAAAAATTACGGTCTTTGCTATGAGACACCCGAAGATCGTGTGTTTGCTCGTGGACACTATAAAAAAGTGGTAATTAGCTAATGGACACTTCTCA[C/T]
ATTATTTTATTATTTCTAGTCAAAATGGAGAGAGAAAGAGTTGTGTAAGTACCAAAATACCCCTGCTGTCTCTTCTTTTCTTTTCCCATTCTTCTTCCTC

Reverse complement sequence

GAGGAAGAAGAATGGGAAAAGAAAAGAAGAGACAGCAGGGGTATTTTGGTACTTACACAACTCTTTCTCTCTCCATTTTGACTAGAAATAATAAAATAAT[G/A]
TGAGAAGTGTCCATTAGCTAATTACCACTTTTTTATAGTGTCCACGAGCAAACACACGATCTTCGGGTGTCTCATAGCAAAGACCGTAATTTTTCGGTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.30%	17.10%	0.59%	2.01%	NA
All Indica	2759	85.00%	11.50%	0.33%	3.12%	NA
All Japonica	1512	73.50%	25.50%	0.99%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	0.30%	0.00%	1.34%	NA
Indica II	465	67.10%	31.80%	0.43%	0.65%	NA
Indica III	913	84.60%	9.40%	0.55%	5.48%	NA
Indica Intermediate	786	86.10%	10.40%	0.25%	3.18%	NA
Temperate Japonica	767	81.00%	17.60%	1.43%	0.00%	NA
Tropical Japonica	504	78.80%	21.00%	0.20%	0.00%	NA
Japonica Intermediate	241	38.60%	59.80%	1.24%	0.41%	NA
VI/Aromatic	96	8.30%	82.30%	2.08%	7.29%	NA
Intermediate	90	65.60%	31.10%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001385374	C -> T	LOC_Os10g03280.1	upstream_gene_variant ; 3431.0bp to feature; MODIFIER	silent_mutation	Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618	N	N	N	N
vg1001385374	C -> T	LOC_Os10g03260.1	downstream_gene_variant ; 2859.0bp to feature; MODIFIER	silent_mutation	Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618	N	N	N	N
vg1001385374	C -> T	LOC_Os10g03270.1	intron_variant ; MODIFIER	silent_mutation	Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618	N	N	N	N
vg1001385374	C -> DEL	N	N	silent_mutation	Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001385374	NA	1.40E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374	NA	8.32E-06	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374	3.04E-06	1.52E-06	mr1685	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374	NA	1.52E-06	mr1820	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374	NA	1.58E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374	NA	2.23E-08	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374	NA	7.40E-07	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251