\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001385374:

Variant ID: vg1001385374 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1385374
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACACCGAAAAATTACGGTCTTTGCTATGAGACACCCGAAGATCGTGTGTTTGCTCGTGGACACTATAAAAAAGTGGTAATTAGCTAATGGACACTTCTCA[C/T]
ATTATTTTATTATTTCTAGTCAAAATGGAGAGAGAAAGAGTTGTGTAAGTACCAAAATACCCCTGCTGTCTCTTCTTTTCTTTTCCCATTCTTCTTCCTC

Reverse complement sequence

GAGGAAGAAGAATGGGAAAAGAAAAGAAGAGACAGCAGGGGTATTTTGGTACTTACACAACTCTTTCTCTCTCCATTTTGACTAGAAATAATAAAATAAT[G/A]
TGAGAAGTGTCCATTAGCTAATTACCACTTTTTTATAGTGTCCACGAGCAAACACACGATCTTCGGGTGTCTCATAGCAAAGACCGTAATTTTTCGGTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 17.10% 0.59% 2.01% NA
All Indica  2759 85.00% 11.50% 0.33% 3.12% NA
All Japonica  1512 73.50% 25.50% 0.99% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 0.30% 0.00% 1.34% NA
Indica II  465 67.10% 31.80% 0.43% 0.65% NA
Indica III  913 84.60% 9.40% 0.55% 5.48% NA
Indica Intermediate  786 86.10% 10.40% 0.25% 3.18% NA
Temperate Japonica  767 81.00% 17.60% 1.43% 0.00% NA
Tropical Japonica  504 78.80% 21.00% 0.20% 0.00% NA
Japonica Intermediate  241 38.60% 59.80% 1.24% 0.41% NA
VI/Aromatic  96 8.30% 82.30% 2.08% 7.29% NA
Intermediate  90 65.60% 31.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001385374 C -> T LOC_Os10g03280.1 upstream_gene_variant ; 3431.0bp to feature; MODIFIER silent_mutation Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N
vg1001385374 C -> T LOC_Os10g03260.1 downstream_gene_variant ; 2859.0bp to feature; MODIFIER silent_mutation Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N
vg1001385374 C -> T LOC_Os10g03270.1 intron_variant ; MODIFIER silent_mutation Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N
vg1001385374 C -> DEL N N silent_mutation Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001385374 NA 1.40E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374 NA 8.32E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374 3.04E-06 1.52E-06 mr1685 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374 NA 1.52E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374 NA 1.58E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374 NA 2.23E-08 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385374 NA 7.40E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251