\
| Variant ID: vg1001385374 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1385374 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 117. )
ACACCGAAAAATTACGGTCTTTGCTATGAGACACCCGAAGATCGTGTGTTTGCTCGTGGACACTATAAAAAAGTGGTAATTAGCTAATGGACACTTCTCA[C/T]
ATTATTTTATTATTTCTAGTCAAAATGGAGAGAGAAAGAGTTGTGTAAGTACCAAAATACCCCTGCTGTCTCTTCTTTTCTTTTCCCATTCTTCTTCCTC
GAGGAAGAAGAATGGGAAAAGAAAAGAAGAGACAGCAGGGGTATTTTGGTACTTACACAACTCTTTCTCTCTCCATTTTGACTAGAAATAATAAAATAAT[G/A]
TGAGAAGTGTCCATTAGCTAATTACCACTTTTTTATAGTGTCCACGAGCAAACACACGATCTTCGGGTGTCTCATAGCAAAGACCGTAATTTTTCGGTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.30% | 17.10% | 0.59% | 2.01% | NA |
| All Indica | 2759 | 85.00% | 11.50% | 0.33% | 3.12% | NA |
| All Japonica | 1512 | 73.50% | 25.50% | 0.99% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.30% | 0.00% | 1.34% | NA |
| Indica II | 465 | 67.10% | 31.80% | 0.43% | 0.65% | NA |
| Indica III | 913 | 84.60% | 9.40% | 0.55% | 5.48% | NA |
| Indica Intermediate | 786 | 86.10% | 10.40% | 0.25% | 3.18% | NA |
| Temperate Japonica | 767 | 81.00% | 17.60% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 78.80% | 21.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 38.60% | 59.80% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 8.30% | 82.30% | 2.08% | 7.29% | NA |
| Intermediate | 90 | 65.60% | 31.10% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001385374 | C -> T | LOC_Os10g03280.1 | upstream_gene_variant ; 3431.0bp to feature; MODIFIER | silent_mutation | Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618 | N | N | N | N |
| vg1001385374 | C -> T | LOC_Os10g03260.1 | downstream_gene_variant ; 2859.0bp to feature; MODIFIER | silent_mutation | Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618 | N | N | N | N |
| vg1001385374 | C -> T | LOC_Os10g03270.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618 | N | N | N | N |
| vg1001385374 | C -> DEL | N | N | silent_mutation | Average:59.254; most accessible tissue: Minghui63 flag leaf, score: 86.618 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001385374 | NA | 1.40E-06 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385374 | NA | 8.32E-06 | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385374 | 3.04E-06 | 1.52E-06 | mr1685 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385374 | NA | 1.52E-06 | mr1820 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385374 | NA | 1.58E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385374 | NA | 2.23E-08 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385374 | NA | 7.40E-07 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |