\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001385051:

Variant ID: vg1001385051 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1385051
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GACATATTTTGTTAAGGTCAGCTTTTGACTTTGGATACCACAACAATTATAATTTTATATCTTTATTTGTGATTGATTGAAAAATGAAGTGCTGCACATT[A/G]
GAGGAAACAATCCAATTACTTCATGAATTCTCTAAAATGTGCTCAAATAATCCAAGTGTGTCAAAACGATCTTTCATGTAAGTGCCCTAGAATATATTCT

Reverse complement sequence

AGAATATATTCTAGGGCACTTACATGAAAGATCGTTTTGACACACTTGGATTATTTGAGCACATTTTAGAGAATTCATGAAGTAATTGGATTGTTTCCTC[T/C]
AATGTGCAGCACTTCATTTTTCAATCAATCACAAATAAAGATATAAAATTATAATTGTTGTGGTATCCAAAGTCAAAAGCTGACCTTAACAAAATATGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 13.50% 0.15% 1.40% NA
All Indica  2759 74.60% 22.80% 0.25% 2.36% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 60.30% 38.50% 0.00% 1.18% NA
Indica II  465 72.30% 27.30% 0.00% 0.43% NA
Indica III  913 82.50% 13.30% 0.55% 3.72% NA
Indica Intermediate  786 77.70% 19.20% 0.25% 2.80% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001385051 A -> G LOC_Os10g03280.1 upstream_gene_variant ; 3754.0bp to feature; MODIFIER silent_mutation Average:38.568; most accessible tissue: Callus, score: 61.84 N N N N
vg1001385051 A -> G LOC_Os10g03260.1 downstream_gene_variant ; 2536.0bp to feature; MODIFIER silent_mutation Average:38.568; most accessible tissue: Callus, score: 61.84 N N N N
vg1001385051 A -> G LOC_Os10g03270.1 intron_variant ; MODIFIER silent_mutation Average:38.568; most accessible tissue: Callus, score: 61.84 N N N N
vg1001385051 A -> DEL N N silent_mutation Average:38.568; most accessible tissue: Callus, score: 61.84 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001385051 4.02E-10 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051 1.25E-10 1.12E-14 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051 1.97E-08 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051 1.04E-08 7.94E-11 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051 1.32E-07 NA mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051 3.14E-07 5.10E-11 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051 8.07E-08 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051 1.28E-08 2.12E-13 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051 3.31E-12 NA mr1721_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051 3.33E-12 5.27E-15 mr1721_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251