\
| Variant ID: vg1001385051 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1385051 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 119. )
GACATATTTTGTTAAGGTCAGCTTTTGACTTTGGATACCACAACAATTATAATTTTATATCTTTATTTGTGATTGATTGAAAAATGAAGTGCTGCACATT[A/G]
GAGGAAACAATCCAATTACTTCATGAATTCTCTAAAATGTGCTCAAATAATCCAAGTGTGTCAAAACGATCTTTCATGTAAGTGCCCTAGAATATATTCT
AGAATATATTCTAGGGCACTTACATGAAAGATCGTTTTGACACACTTGGATTATTTGAGCACATTTTAGAGAATTCATGAAGTAATTGGATTGTTTCCTC[T/C]
AATGTGCAGCACTTCATTTTTCAATCAATCACAAATAAAGATATAAAATTATAATTGTTGTGGTATCCAAAGTCAAAAGCTGACCTTAACAAAATATGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.00% | 13.50% | 0.15% | 1.40% | NA |
| All Indica | 2759 | 74.60% | 22.80% | 0.25% | 2.36% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.30% | 38.50% | 0.00% | 1.18% | NA |
| Indica II | 465 | 72.30% | 27.30% | 0.00% | 0.43% | NA |
| Indica III | 913 | 82.50% | 13.30% | 0.55% | 3.72% | NA |
| Indica Intermediate | 786 | 77.70% | 19.20% | 0.25% | 2.80% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001385051 | A -> G | LOC_Os10g03280.1 | upstream_gene_variant ; 3754.0bp to feature; MODIFIER | silent_mutation | Average:38.568; most accessible tissue: Callus, score: 61.84 | N | N | N | N |
| vg1001385051 | A -> G | LOC_Os10g03260.1 | downstream_gene_variant ; 2536.0bp to feature; MODIFIER | silent_mutation | Average:38.568; most accessible tissue: Callus, score: 61.84 | N | N | N | N |
| vg1001385051 | A -> G | LOC_Os10g03270.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.568; most accessible tissue: Callus, score: 61.84 | N | N | N | N |
| vg1001385051 | A -> DEL | N | N | silent_mutation | Average:38.568; most accessible tissue: Callus, score: 61.84 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001385051 | 4.02E-10 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385051 | 1.25E-10 | 1.12E-14 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385051 | 1.97E-08 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385051 | 1.04E-08 | 7.94E-11 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385051 | 1.32E-07 | NA | mr1721 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385051 | 3.14E-07 | 5.10E-11 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385051 | 8.07E-08 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385051 | 1.28E-08 | 2.12E-13 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385051 | 3.31E-12 | NA | mr1721_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001385051 | 3.33E-12 | 5.27E-15 | mr1721_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |