Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001385051:

Variant ID: vg1001385051 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1385051
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GACATATTTTGTTAAGGTCAGCTTTTGACTTTGGATACCACAACAATTATAATTTTATATCTTTATTTGTGATTGATTGAAAAATGAAGTGCTGCACATT[A/G]
GAGGAAACAATCCAATTACTTCATGAATTCTCTAAAATGTGCTCAAATAATCCAAGTGTGTCAAAACGATCTTTCATGTAAGTGCCCTAGAATATATTCT

Reverse complement sequence

AGAATATATTCTAGGGCACTTACATGAAAGATCGTTTTGACACACTTGGATTATTTGAGCACATTTTAGAGAATTCATGAAGTAATTGGATTGTTTCCTC[T/C]
AATGTGCAGCACTTCATTTTTCAATCAATCACAAATAAAGATATAAAATTATAATTGTTGTGGTATCCAAAGTCAAAAGCTGACCTTAACAAAATATGTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	13.50%	0.15%	1.40%	NA
All Indica	2759	74.60%	22.80%	0.25%	2.36%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	60.30%	38.50%	0.00%	1.18%	NA
Indica II	465	72.30%	27.30%	0.00%	0.43%	NA
Indica III	913	82.50%	13.30%	0.55%	3.72%	NA
Indica Intermediate	786	77.70%	19.20%	0.25%	2.80%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001385051	A -> G	LOC_Os10g03280.1	upstream_gene_variant ; 3754.0bp to feature; MODIFIER	silent_mutation	Average:38.568; most accessible tissue: Callus, score: 61.84	N	N	N	N
vg1001385051	A -> G	LOC_Os10g03260.1	downstream_gene_variant ; 2536.0bp to feature; MODIFIER	silent_mutation	Average:38.568; most accessible tissue: Callus, score: 61.84	N	N	N	N
vg1001385051	A -> G	LOC_Os10g03270.1	intron_variant ; MODIFIER	silent_mutation	Average:38.568; most accessible tissue: Callus, score: 61.84	N	N	N	N
vg1001385051	A -> DEL	N	N	silent_mutation	Average:38.568; most accessible tissue: Callus, score: 61.84	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001385051	4.02E-10	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051	1.25E-10	1.12E-14	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051	1.97E-08	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051	1.04E-08	7.94E-11	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051	1.32E-07	NA	mr1721	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051	3.14E-07	5.10E-11	mr1721	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051	8.07E-08	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051	1.28E-08	2.12E-13	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051	3.31E-12	NA	mr1721_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001385051	3.33E-12	5.27E-15	mr1721_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251