Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001381368:

Variant ID: vg1001381368 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1381368
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAATATATCTCCAGTAAAAAAAAATTACATACTTCCTCCATTTTAATAGATGATGCCGTCGAATTTAACATGATATTTAAGATGTCTTCTTATTAAA[T/A]
ATATATAAATATTATTTATTTTGTTGTGACATATTTTATTAATACAGAACTTTAAGTATGATTTATAATTTAATAATTTTTATTTACATCTATTGTTTGA

Reverse complement sequence

TCAAACAATAGATGTAAATAAAAATTATTAAATTATAAATCATACTTAAAGTTCTGTATTAATAAAATATGTCACAACAAAATAAATAATATTTATATAT[A/T]
TTTAATAAGAAGACATCTTAAATATCATGTTAAATTCGACGGCATCATCTATTAAAATGGAGGAAGTATGTAATTTTTTTTTACTGGAGATATATTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	3.90%	3.03%	0.51%	NA
All Indica	2759	88.10%	6.10%	4.93%	0.87%	NA
All Japonica	1512	99.70%	0.10%	0.13%	0.00%	NA
Aus	269	97.00%	2.60%	0.37%	0.00%	NA
Indica I	595	93.60%	1.30%	4.03%	1.01%	NA
Indica II	465	92.50%	1.90%	4.09%	1.51%	NA
Indica III	913	80.60%	11.80%	7.01%	0.55%	NA
Indica Intermediate	786	90.20%	5.30%	3.69%	0.76%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	93.30%	2.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001381368	T -> A	LOC_Os10g03260.1	upstream_gene_variant ; 322.0bp to feature; MODIFIER	silent_mutation	Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271	N	N	N	N
vg1001381368	T -> A	LOC_Os10g03250.1	downstream_gene_variant ; 4660.0bp to feature; MODIFIER	silent_mutation	Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271	N	N	N	N
vg1001381368	T -> A	LOC_Os10g03270.1	downstream_gene_variant ; 2952.0bp to feature; MODIFIER	silent_mutation	Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271	N	N	N	N
vg1001381368	T -> A	LOC_Os10g03250-LOC_Os10g03260	intergenic_region ; MODIFIER	silent_mutation	Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271	N	N	N	N
vg1001381368	T -> DEL	N	N	silent_mutation	Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001381368	3.40E-24	3.64E-19	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001381368	9.72E-22	4.48E-18	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001381368	4.05E-10	1.38E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001381368	5.23E-30	3.86E-24	mr1486_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001381368	6.37E-27	3.86E-15	mr1588_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251