\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001381368:

Variant ID: vg1001381368 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1381368
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAATATATCTCCAGTAAAAAAAAATTACATACTTCCTCCATTTTAATAGATGATGCCGTCGAATTTAACATGATATTTAAGATGTCTTCTTATTAAA[T/A]
ATATATAAATATTATTTATTTTGTTGTGACATATTTTATTAATACAGAACTTTAAGTATGATTTATAATTTAATAATTTTTATTTACATCTATTGTTTGA

Reverse complement sequence

TCAAACAATAGATGTAAATAAAAATTATTAAATTATAAATCATACTTAAAGTTCTGTATTAATAAAATATGTCACAACAAAATAAATAATATTTATATAT[A/T]
TTTAATAAGAAGACATCTTAAATATCATGTTAAATTCGACGGCATCATCTATTAAAATGGAGGAAGTATGTAATTTTTTTTTACTGGAGATATATTTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 3.90% 3.03% 0.51% NA
All Indica  2759 88.10% 6.10% 4.93% 0.87% NA
All Japonica  1512 99.70% 0.10% 0.13% 0.00% NA
Aus  269 97.00% 2.60% 0.37% 0.00% NA
Indica I  595 93.60% 1.30% 4.03% 1.01% NA
Indica II  465 92.50% 1.90% 4.09% 1.51% NA
Indica III  913 80.60% 11.80% 7.01% 0.55% NA
Indica Intermediate  786 90.20% 5.30% 3.69% 0.76% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 93.30% 2.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001381368 T -> A LOC_Os10g03260.1 upstream_gene_variant ; 322.0bp to feature; MODIFIER silent_mutation Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271 N N N N
vg1001381368 T -> A LOC_Os10g03250.1 downstream_gene_variant ; 4660.0bp to feature; MODIFIER silent_mutation Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271 N N N N
vg1001381368 T -> A LOC_Os10g03270.1 downstream_gene_variant ; 2952.0bp to feature; MODIFIER silent_mutation Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271 N N N N
vg1001381368 T -> A LOC_Os10g03250-LOC_Os10g03260 intergenic_region ; MODIFIER silent_mutation Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271 N N N N
vg1001381368 T -> DEL N N silent_mutation Average:24.451; most accessible tissue: Zhenshan97 young leaf, score: 33.271 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001381368 3.40E-24 3.64E-19 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001381368 9.72E-22 4.48E-18 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001381368 4.05E-10 1.38E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001381368 5.23E-30 3.86E-24 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001381368 6.37E-27 3.86E-15 mr1588_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251