\
| Variant ID: vg1001381044 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1381044 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTTGAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAACGCTGTCAAATGTTTAGAAACGGAGGGAGTACATATCAACATGCCACTTGTTGTTGTC[A/G]
GATATATATATGCATGCCCTGTTTTGGCGGACACGGGATTATAAGAAGCCAGACAATGAAAATCTAGAAAAGTTAGTACAAAAGTTATGTTTTCACAGCT
AGCTGTGAAAACATAACTTTTGTACTAACTTTTCTAGATTTTCATTGTCTGGCTTCTTATAATCCCGTGTCCGCCAAAACAGGGCATGCATATATATATC[T/C]
GACAACAACAAGTGGCATGTTGATATGTACTCCCTCCGTTTCTAAACATTTGACAGCGTTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTCAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.00% | 6.50% | 2.79% | 10.66% | NA |
| All Indica | 2759 | 72.70% | 10.30% | 2.90% | 14.06% | NA |
| All Japonica | 1512 | 95.60% | 0.20% | 1.98% | 2.25% | NA |
| Aus | 269 | 60.60% | 2.60% | 7.43% | 29.37% | NA |
| Indica I | 595 | 73.40% | 1.30% | 3.87% | 21.34% | NA |
| Indica II | 465 | 80.90% | 4.30% | 1.72% | 13.12% | NA |
| Indica III | 913 | 67.60% | 19.90% | 3.07% | 9.42% | NA |
| Indica Intermediate | 786 | 73.40% | 9.40% | 2.67% | 14.50% | NA |
| Temperate Japonica | 767 | 99.10% | 0.10% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 89.10% | 0.00% | 5.95% | 4.96% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 91.70% | 7.30% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001381044 | A -> G | LOC_Os10g03260.1 | upstream_gene_variant ; 646.0bp to feature; MODIFIER | silent_mutation | Average:35.369; most accessible tissue: Callus, score: 64.655 | N | N | N | N |
| vg1001381044 | A -> G | LOC_Os10g03250.1 | downstream_gene_variant ; 4336.0bp to feature; MODIFIER | silent_mutation | Average:35.369; most accessible tissue: Callus, score: 64.655 | N | N | N | N |
| vg1001381044 | A -> G | LOC_Os10g03270.1 | downstream_gene_variant ; 3276.0bp to feature; MODIFIER | silent_mutation | Average:35.369; most accessible tissue: Callus, score: 64.655 | N | N | N | N |
| vg1001381044 | A -> G | LOC_Os10g03250-LOC_Os10g03260 | intergenic_region ; MODIFIER | silent_mutation | Average:35.369; most accessible tissue: Callus, score: 64.655 | N | N | N | N |
| vg1001381044 | A -> DEL | N | N | silent_mutation | Average:35.369; most accessible tissue: Callus, score: 64.655 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001381044 | 2.39E-24 | 2.37E-19 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001381044 | 7.31E-22 | 3.12E-18 | mr1548 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001381044 | 3.32E-10 | 1.13E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001381044 | 3.89E-30 | 3.08E-24 | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001381044 | 7.31E-27 | 4.71E-15 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |