\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001376210:

Variant ID: vg1001376210 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1376210
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAAACGGGAGAACGTCAGGTTTTCGGGACGGATATCTTAAGGGAAGCAGAAGAAAAGGTAAAGATCATTCAAGAAAGATTGCGTGTGGCTCAATCTCG[A/T]
CATAAGAGTTATGCCGACAATCGCCGTAGAGATTTGAGTTTTGAAGAAGGAGATTATGTGTATCTTCGTGTCACGCCTTTTCGAGGAGTTCATCGTTTTC

Reverse complement sequence

GAAAACGATGAACTCCTCGAAAAGGCGTGACACGAAGATACACATAATCTCCTTCTTCAAAACTCAAATCTCTACGGCGATTGTCGGCATAACTCTTATG[T/A]
CGAGATTGAGCCACACGCAATCTTTCTTGAATGATCTTTACCTTTTCTTCTGCTTCCCTTAAGATATCCGTCCCGAAAACCTGACGTTCTCCCGTTTGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 4.80% 30.98% 8.68% NA
All Indica  2759 63.60% 5.60% 21.67% 9.10% NA
All Japonica  1512 48.70% 0.90% 40.15% 10.19% NA
Aus  269 24.50% 19.30% 56.13% 0.00% NA
Indica I  595 59.00% 0.70% 23.70% 16.64% NA
Indica II  465 44.70% 15.90% 26.02% 13.33% NA
Indica III  913 74.90% 4.60% 16.65% 3.83% NA
Indica Intermediate  786 65.30% 4.30% 23.41% 7.00% NA
Temperate Japonica  767 74.80% 0.30% 14.08% 10.82% NA
Tropical Japonica  504 19.80% 0.60% 73.21% 6.35% NA
Japonica Intermediate  241 26.10% 3.70% 53.94% 16.18% NA
VI/Aromatic  96 17.70% 6.20% 76.04% 0.00% NA
Intermediate  90 53.30% 2.20% 38.89% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001376210 A -> T LOC_Os10g03250.1 synonymous_variant ; p.Arg1278Arg; LOW synonymous_codon Average:15.496; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1001376210 A -> T LOC_Os10g03250.1 synonymous_variant ; p.Arg1278Arg; LOW nonsynonymous_codon ; R1278H Average:15.496; most accessible tissue: Zhenshan97 panicle, score: 28.447 benign 1.047 DELETERIOUS 0.02
vg1001376210 A -> DEL LOC_Os10g03250.1 N frameshift_variant Average:15.496; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001376210 NA 8.39E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 NA 3.16E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 5.79E-06 NA mr1509 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 NA 2.40E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 NA 2.28E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 NA 1.66E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 NA 4.09E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 NA 4.84E-07 mr1685 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 8.81E-06 4.33E-07 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 NA 3.07E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001376210 4.44E-06 1.77E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251