\
| Variant ID: vg1001376210 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1376210 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCAAACGGGAGAACGTCAGGTTTTCGGGACGGATATCTTAAGGGAAGCAGAAGAAAAGGTAAAGATCATTCAAGAAAGATTGCGTGTGGCTCAATCTCG[A/T]
CATAAGAGTTATGCCGACAATCGCCGTAGAGATTTGAGTTTTGAAGAAGGAGATTATGTGTATCTTCGTGTCACGCCTTTTCGAGGAGTTCATCGTTTTC
GAAAACGATGAACTCCTCGAAAAGGCGTGACACGAAGATACACATAATCTCCTTCTTCAAAACTCAAATCTCTACGGCGATTGTCGGCATAACTCTTATG[T/A]
CGAGATTGAGCCACACGCAATCTTTCTTGAATGATCTTTACCTTTTCTTCTGCTTCCCTTAAGATATCCGTCCCGAAAACCTGACGTTCTCCCGTTTGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.50% | 4.80% | 30.98% | 8.68% | NA |
| All Indica | 2759 | 63.60% | 5.60% | 21.67% | 9.10% | NA |
| All Japonica | 1512 | 48.70% | 0.90% | 40.15% | 10.19% | NA |
| Aus | 269 | 24.50% | 19.30% | 56.13% | 0.00% | NA |
| Indica I | 595 | 59.00% | 0.70% | 23.70% | 16.64% | NA |
| Indica II | 465 | 44.70% | 15.90% | 26.02% | 13.33% | NA |
| Indica III | 913 | 74.90% | 4.60% | 16.65% | 3.83% | NA |
| Indica Intermediate | 786 | 65.30% | 4.30% | 23.41% | 7.00% | NA |
| Temperate Japonica | 767 | 74.80% | 0.30% | 14.08% | 10.82% | NA |
| Tropical Japonica | 504 | 19.80% | 0.60% | 73.21% | 6.35% | NA |
| Japonica Intermediate | 241 | 26.10% | 3.70% | 53.94% | 16.18% | NA |
| VI/Aromatic | 96 | 17.70% | 6.20% | 76.04% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 2.20% | 38.89% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001376210 | A -> T | LOC_Os10g03250.1 | synonymous_variant ; p.Arg1278Arg; LOW | synonymous_codon | Average:15.496; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg1001376210 | A -> T | LOC_Os10g03250.1 | synonymous_variant ; p.Arg1278Arg; LOW | nonsynonymous_codon ; R1278H | Average:15.496; most accessible tissue: Zhenshan97 panicle, score: 28.447 | benign |
1.047 |
DELETERIOUS | 0.02 |
| vg1001376210 | A -> DEL | LOC_Os10g03250.1 | N | frameshift_variant | Average:15.496; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001376210 | NA | 8.39E-06 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | NA | 3.16E-06 | mr1332 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | 5.79E-06 | NA | mr1509 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | NA | 2.40E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | NA | 2.28E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | NA | 1.66E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | NA | 4.09E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | NA | 4.84E-07 | mr1685 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | 8.81E-06 | 4.33E-07 | mr1775 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | NA | 3.07E-06 | mr1937 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001376210 | 4.44E-06 | 1.77E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |