\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001364496:

Variant ID: vg1001364496 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1364496
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, C: 0.09, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


ATACGGGCCCAAGGATATCAAGACTAGAGGGAGGAGGCCGCCCCCAGTGCCACGTGGCCCTCCCTCGAGGGGGGTCGAGCCTGGGGCCGAGCGGCGGCCG[A/C]
CCCCTCCCGTGACTAGGTGTTGGGCTCTCCCGGCCCCCTTCGCCGGTCGCCACATGCGGTGAGTTGGATGGCCGCTTCCGAGCGCCCACCTACTCGCATT

Reverse complement sequence

AATGCGAGTAGGTGGGCGCTCGGAAGCGGCCATCCAACTCACCGCATGTGGCGACCGGCGAAGGGGGCCGGGAGAGCCCAACACCTAGTCACGGGAGGGG[T/G]
CGGCCGCCGCTCGGCCCCAGGCTCGACCCCCCTCGAGGGAGGGCCACGTGGCACTGGGGGCGGCCTCCTCCCTCTAGTCTTGATATCCTTGGGCCCGTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 28.40% 0.17% 19.21% NA
All Indica  2759 53.30% 15.20% 0.25% 31.24% NA
All Japonica  1512 45.80% 53.50% 0.07% 0.66% NA
Aus  269 91.80% 0.70% 0.00% 7.43% NA
Indica I  595 60.80% 1.50% 0.00% 37.65% NA
Indica II  465 38.50% 32.00% 0.43% 29.03% NA
Indica III  913 51.30% 15.60% 0.44% 32.75% NA
Indica Intermediate  786 58.80% 15.10% 0.13% 25.95% NA
Temperate Japonica  767 71.20% 27.80% 0.00% 1.04% NA
Tropical Japonica  504 20.40% 79.40% 0.20% 0.00% NA
Japonica Intermediate  241 17.80% 81.30% 0.00% 0.83% NA
VI/Aromatic  96 12.50% 81.20% 0.00% 6.25% NA
Intermediate  90 50.00% 38.90% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001364496 A -> C LOC_Os10g03240.1 upstream_gene_variant ; 2120.0bp to feature; MODIFIER silent_mutation Average:69.482; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg1001364496 A -> C LOC_Os10g03230.1 downstream_gene_variant ; 4180.0bp to feature; MODIFIER silent_mutation Average:69.482; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg1001364496 A -> C LOC_Os10g03230-LOC_Os10g03240 intergenic_region ; MODIFIER silent_mutation Average:69.482; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg1001364496 A -> DEL N N silent_mutation Average:69.482; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001364496 NA 4.99E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.62E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 3.45E-12 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.99E-07 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 4.54E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 4.04E-15 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 3.76E-06 4.15E-10 mr1206 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 4.88E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 9.97E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.02E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.69E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 5.78E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 9.74E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 8.85E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 9.86E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.66E-08 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 8.79E-07 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.23E-17 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.97E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 6.13E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.77E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 6.14E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.28E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.41E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 3.85E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 6.04E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 3.91E-06 mr1492 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 3.88E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 9.84E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 8.01E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 7.99E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.68E-15 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.66E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.81E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 5.52E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.86E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.92E-08 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 8.23E-10 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 4.84E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.67E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 3.33E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 3.58E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 4.57E-06 1.22E-16 mr1775 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 7.22E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.84E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.84E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.79E-06 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 5.45E-09 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 6.23E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 3.93E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 4.44E-06 NA mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 1.59E-08 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 9.29E-06 NA mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 NA 2.11E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001364496 2.13E-08 3.79E-15 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251