RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1001361549:

Variant ID: vg1001361549 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1361549
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGAGATCTGTTTTTCTACTTTCTATTTTTAGTTTAGGAAACCTAAAAACAAATTTTGGGGGAGATTATATGTTAGAGCATCACCGATAGATTACGTAC[G/A]
ATCTCTCTCCAAAAATTTGTTTTTTGTTTTTCTAAACTAAAAATAGGAAGTAAATAAACTGATCTCCCAAAGAGGAAGTCTAAATTTTTATGTAAAAAAA

Reverse complement sequence

TTTTTTTACATAAAAATTTAGACTTCCTCTTTGGGAGATCAGTTTATTTACTTCCTATTTTTAGTTTAGAAAAACAAAAAACAAATTTTTGGAGAGAGAT[C/T]
GTACGTAATCTATCGGTGATGCTCTAACATATAATCTCCCCCAAAATTTGTTTTTAGGTTTCCTAAACTAAAAATAGAAAGTAGAAAAACAGATCTCTCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	13.20%	0.17%	0.00%	NA
All Indica	2759	98.90%	0.90%	0.22%	0.00%	NA
All Japonica	1512	61.70%	38.20%	0.07%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	98.00%	1.50%	0.50%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	0.90%	0.38%	0.00%	NA
Temperate Japonica	767	29.50%	70.50%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	87.10%	12.40%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001361549	G -> A	LOC_Os10g03220.1	downstream_gene_variant ; 2368.0bp to feature; MODIFIER	silent_mutation	Average:41.71; most accessible tissue: Callus, score: 73.215	N	N	N	N
vg1001361549	G -> A	LOC_Os10g03230.1	downstream_gene_variant ; 1233.0bp to feature; MODIFIER	silent_mutation	Average:41.71; most accessible tissue: Callus, score: 73.215	N	N	N	N
vg1001361549	G -> A	LOC_Os10g03230-LOC_Os10g03240	intergenic_region ; MODIFIER	silent_mutation	Average:41.71; most accessible tissue: Callus, score: 73.215	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001361549	NA	4.21E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001361549	NA	4.70E-09	mr1026	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001361549	NA	1.24E-07	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001361549	NA	7.23E-07	mr1161	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001361549	NA	4.15E-08	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001361549	3.68E-07	9.04E-42	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001361549	NA	2.76E-13	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001361549	NA	2.78E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001361549	NA	7.95E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001361549	NA	1.06E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 28 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg1001361549:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact