\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001349943:

Variant ID: vg1001349943 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1349943
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCGCGAGCGATGACGTCAGCGAGAACTCATCGGGGTGCGTCGGGATGGTAGTCGTGACACCGCACTCCCCGGCGAGTTGGTGCAGGCTGGTGAACGA[T/C]
GTTGCAGCGAACCGCGGATGTCGATCATACTGCCCTCGAGCTCCGACATCCGGTGCTCGAGCCTGCGCCGCTGCATCTCGTTGCCGGCTACCAGCTCCCT

Reverse complement sequence

AGGGAGCTGGTAGCCGGCAACGAGATGCAGCGGCGCAGGCTCGAGCACCGGATGTCGGAGCTCGAGGGCAGTATGATCGACATCCGCGGTTCGCTGCAAC[A/G]
TCGTTCACCAGCCTGCACCAACTCGCCGGGGAGTGCGGTGTCACGACTACCATCCCGACGCACCCCGATGAGTTCTCGCTGACGTCATCGCTCGCGGAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.40% 15.30% 2.20% 47.04% NA
All Indica  2759 46.60% 3.80% 2.68% 46.94% NA
All Japonica  1512 7.00% 39.30% 1.46% 52.25% NA
Aus  269 88.50% 1.90% 0.74% 8.92% NA
Indica I  595 52.40% 2.40% 2.18% 43.03% NA
Indica II  465 31.00% 4.30% 3.23% 61.51% NA
Indica III  913 46.30% 5.10% 2.30% 46.22% NA
Indica Intermediate  786 51.80% 2.90% 3.18% 42.11% NA
Temperate Japonica  767 1.20% 71.60% 0.52% 26.73% NA
Tropical Japonica  504 16.70% 2.80% 3.17% 77.38% NA
Japonica Intermediate  241 5.40% 12.90% 0.83% 80.91% NA
VI/Aromatic  96 12.50% 4.20% 2.08% 81.25% NA
Intermediate  90 35.60% 20.00% 4.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001349943 T -> C LOC_Os10g03190.1 upstream_gene_variant ; 893.0bp to feature; MODIFIER silent_mutation Average:47.203; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1001349943 T -> C LOC_Os10g03200.1 downstream_gene_variant ; 2697.0bp to feature; MODIFIER silent_mutation Average:47.203; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1001349943 T -> C LOC_Os10g03190-LOC_Os10g03200 intergenic_region ; MODIFIER silent_mutation Average:47.203; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N
vg1001349943 T -> DEL N N silent_mutation Average:47.203; most accessible tissue: Minghui63 young leaf, score: 80.562 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001349943 NA 5.94E-40 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001349943 NA 1.91E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001349943 NA 4.09E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001349943 2.51E-06 NA mr1233_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001349943 NA 1.50E-47 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251