\
| Variant ID: vg1001349943 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1349943 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 49. )
ATTCCGCGAGCGATGACGTCAGCGAGAACTCATCGGGGTGCGTCGGGATGGTAGTCGTGACACCGCACTCCCCGGCGAGTTGGTGCAGGCTGGTGAACGA[T/C]
GTTGCAGCGAACCGCGGATGTCGATCATACTGCCCTCGAGCTCCGACATCCGGTGCTCGAGCCTGCGCCGCTGCATCTCGTTGCCGGCTACCAGCTCCCT
AGGGAGCTGGTAGCCGGCAACGAGATGCAGCGGCGCAGGCTCGAGCACCGGATGTCGGAGCTCGAGGGCAGTATGATCGACATCCGCGGTTCGCTGCAAC[A/G]
TCGTTCACCAGCCTGCACCAACTCGCCGGGGAGTGCGGTGTCACGACTACCATCCCGACGCACCCCGATGAGTTCTCGCTGACGTCATCGCTCGCGGAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.40% | 15.30% | 2.20% | 47.04% | NA |
| All Indica | 2759 | 46.60% | 3.80% | 2.68% | 46.94% | NA |
| All Japonica | 1512 | 7.00% | 39.30% | 1.46% | 52.25% | NA |
| Aus | 269 | 88.50% | 1.90% | 0.74% | 8.92% | NA |
| Indica I | 595 | 52.40% | 2.40% | 2.18% | 43.03% | NA |
| Indica II | 465 | 31.00% | 4.30% | 3.23% | 61.51% | NA |
| Indica III | 913 | 46.30% | 5.10% | 2.30% | 46.22% | NA |
| Indica Intermediate | 786 | 51.80% | 2.90% | 3.18% | 42.11% | NA |
| Temperate Japonica | 767 | 1.20% | 71.60% | 0.52% | 26.73% | NA |
| Tropical Japonica | 504 | 16.70% | 2.80% | 3.17% | 77.38% | NA |
| Japonica Intermediate | 241 | 5.40% | 12.90% | 0.83% | 80.91% | NA |
| VI/Aromatic | 96 | 12.50% | 4.20% | 2.08% | 81.25% | NA |
| Intermediate | 90 | 35.60% | 20.00% | 4.44% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001349943 | T -> C | LOC_Os10g03190.1 | upstream_gene_variant ; 893.0bp to feature; MODIFIER | silent_mutation | Average:47.203; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1001349943 | T -> C | LOC_Os10g03200.1 | downstream_gene_variant ; 2697.0bp to feature; MODIFIER | silent_mutation | Average:47.203; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1001349943 | T -> C | LOC_Os10g03190-LOC_Os10g03200 | intergenic_region ; MODIFIER | silent_mutation | Average:47.203; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| vg1001349943 | T -> DEL | N | N | silent_mutation | Average:47.203; most accessible tissue: Minghui63 young leaf, score: 80.562 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001349943 | NA | 5.94E-40 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001349943 | NA | 1.91E-23 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001349943 | NA | 4.09E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001349943 | 2.51E-06 | NA | mr1233_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001349943 | NA | 1.50E-47 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |