\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001344040:

Variant ID: vg1001344040 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1344040
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCTTCCCCTAAAAAGAAAAGAAAAGAAAAGAAAAAAAAGGGAGGGAAAGGCATAGTTATGAGAAATAAAGTTATGCTCCATCAAGCATGAGCATGATG[C/T]
TGAAAAAAAAATTGTAGCCATGCCCTCTCCTAATTAATAAAAGAAGGATTTTTGGGACAAGAAAGTAAGTACAAAGGAGAAGCATTTTCTTTATTTTCCT

Reverse complement sequence

AGGAAAATAAAGAAAATGCTTCTCCTTTGTACTTACTTTCTTGTCCCAAAAATCCTTCTTTTATTAATTAGGAGAGGGCATGGCTACAATTTTTTTTTCA[G/A]
CATCATGCTCATGCTTGATGGAGCATAACTTTATTTCTCATAACTATGCCTTTCCCTCCCTTTTTTTTCTTTTCTTTTCTTTTCTTTTTAGGGGAAGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 1.50% 12.84% 26.83% NA
All Indica  2759 62.40% 0.10% 6.63% 30.88% NA
All Japonica  1512 49.00% 0.00% 24.93% 26.06% NA
Aus  269 91.80% 0.40% 7.43% 0.37% NA
Indica I  595 66.90% 0.00% 4.37% 28.74% NA
Indica II  465 44.70% 0.00% 6.45% 48.82% NA
Indica III  913 64.80% 0.10% 9.20% 25.85% NA
Indica Intermediate  786 66.50% 0.30% 5.47% 27.74% NA
Temperate Japonica  767 74.40% 0.00% 1.17% 24.38% NA
Tropical Japonica  504 23.40% 0.00% 62.30% 14.29% NA
Japonica Intermediate  241 21.60% 0.00% 22.41% 56.02% NA
VI/Aromatic  96 15.60% 67.70% 13.54% 3.12% NA
Intermediate  90 61.10% 3.30% 15.56% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001344040 C -> T LOC_Os10g03180.1 downstream_gene_variant ; 1238.0bp to feature; MODIFIER silent_mutation Average:19.502; most accessible tissue: Minghui63 flower, score: 38.402 N N N N
vg1001344040 C -> T LOC_Os10g03190.1 downstream_gene_variant ; 3721.0bp to feature; MODIFIER silent_mutation Average:19.502; most accessible tissue: Minghui63 flower, score: 38.402 N N N N
vg1001344040 C -> T LOC_Os10g03180-LOC_Os10g03190 intergenic_region ; MODIFIER silent_mutation Average:19.502; most accessible tissue: Minghui63 flower, score: 38.402 N N N N
vg1001344040 C -> DEL N N silent_mutation Average:19.502; most accessible tissue: Minghui63 flower, score: 38.402 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001344040 NA 1.22E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001344040 NA 6.57E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001344040 NA 4.04E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001344040 NA 1.59E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001344040 NA 1.16E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001344040 7.36E-06 NA mr1236_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001344040 NA 7.37E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001344040 NA 3.12E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251