\
| Variant ID: vg1001344040 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1344040 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTCTTCCCCTAAAAAGAAAAGAAAAGAAAAGAAAAAAAAGGGAGGGAAAGGCATAGTTATGAGAAATAAAGTTATGCTCCATCAAGCATGAGCATGATG[C/T]
TGAAAAAAAAATTGTAGCCATGCCCTCTCCTAATTAATAAAAGAAGGATTTTTGGGACAAGAAAGTAAGTACAAAGGAGAAGCATTTTCTTTATTTTCCT
AGGAAAATAAAGAAAATGCTTCTCCTTTGTACTTACTTTCTTGTCCCAAAAATCCTTCTTTTATTAATTAGGAGAGGGCATGGCTACAATTTTTTTTTCA[G/A]
CATCATGCTCATGCTTGATGGAGCATAACTTTATTTCTCATAACTATGCCTTTCCCTCCCTTTTTTTTCTTTTCTTTTCTTTTCTTTTTAGGGGAAGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.80% | 1.50% | 12.84% | 26.83% | NA |
| All Indica | 2759 | 62.40% | 0.10% | 6.63% | 30.88% | NA |
| All Japonica | 1512 | 49.00% | 0.00% | 24.93% | 26.06% | NA |
| Aus | 269 | 91.80% | 0.40% | 7.43% | 0.37% | NA |
| Indica I | 595 | 66.90% | 0.00% | 4.37% | 28.74% | NA |
| Indica II | 465 | 44.70% | 0.00% | 6.45% | 48.82% | NA |
| Indica III | 913 | 64.80% | 0.10% | 9.20% | 25.85% | NA |
| Indica Intermediate | 786 | 66.50% | 0.30% | 5.47% | 27.74% | NA |
| Temperate Japonica | 767 | 74.40% | 0.00% | 1.17% | 24.38% | NA |
| Tropical Japonica | 504 | 23.40% | 0.00% | 62.30% | 14.29% | NA |
| Japonica Intermediate | 241 | 21.60% | 0.00% | 22.41% | 56.02% | NA |
| VI/Aromatic | 96 | 15.60% | 67.70% | 13.54% | 3.12% | NA |
| Intermediate | 90 | 61.10% | 3.30% | 15.56% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001344040 | C -> T | LOC_Os10g03180.1 | downstream_gene_variant ; 1238.0bp to feature; MODIFIER | silent_mutation | Average:19.502; most accessible tissue: Minghui63 flower, score: 38.402 | N | N | N | N |
| vg1001344040 | C -> T | LOC_Os10g03190.1 | downstream_gene_variant ; 3721.0bp to feature; MODIFIER | silent_mutation | Average:19.502; most accessible tissue: Minghui63 flower, score: 38.402 | N | N | N | N |
| vg1001344040 | C -> T | LOC_Os10g03180-LOC_Os10g03190 | intergenic_region ; MODIFIER | silent_mutation | Average:19.502; most accessible tissue: Minghui63 flower, score: 38.402 | N | N | N | N |
| vg1001344040 | C -> DEL | N | N | silent_mutation | Average:19.502; most accessible tissue: Minghui63 flower, score: 38.402 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001344040 | NA | 1.22E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001344040 | NA | 6.57E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001344040 | NA | 4.04E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001344040 | NA | 1.59E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001344040 | NA | 1.16E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001344040 | 7.36E-06 | NA | mr1236_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001344040 | NA | 7.37E-06 | mr1236_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001344040 | NA | 3.12E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |