\
| Variant ID: vg1001343441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1343441 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTATAAAACTTGAAAACACCATAAAAATCTGCAAAATAAAAAATACCAAAAAGATAGGGTAGGTTTGAGTCATGCTAGGTAAGACAAGCTAGTTCTCTTT[A/G]
TTGAAATGATAAATAGTTGCTCTGTTTTATATCTCTGATATATGGGTTCTTGGTAAATACTCTCTCAAAGGTTAAATATAAGTAGCCAACAATTATCTGG
CCAGATAATTGTTGGCTACTTATATTTAACCTTTGAGAGAGTATTTACCAAGAACCCATATATCAGAGATATAAAACAGAGCAACTATTTATCATTTCAA[T/C]
AAAGAGAACTAGCTTGTCTTACCTAGCATGACTCAAACCTACCCTATCTTTTTGGTATTTTTTATTTTGCAGATTTTTATGGTGTTTTCAAGTTTTATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.70% | 0.30% | 11.00% | 23.00% | NA |
| All Indica | 2759 | 72.70% | 0.00% | 4.60% | 22.73% | NA |
| All Japonica | 1512 | 50.50% | 1.00% | 19.78% | 28.77% | NA |
| Aus | 269 | 95.50% | 0.00% | 2.97% | 1.49% | NA |
| Indica I | 595 | 72.80% | 0.00% | 2.52% | 24.71% | NA |
| Indica II | 465 | 55.70% | 0.00% | 6.24% | 38.06% | NA |
| Indica III | 913 | 79.70% | 0.00% | 5.37% | 14.90% | NA |
| Indica Intermediate | 786 | 74.40% | 0.00% | 4.33% | 21.25% | NA |
| Temperate Japonica | 767 | 74.80% | 0.00% | 1.96% | 23.21% | NA |
| Tropical Japonica | 504 | 26.80% | 2.60% | 46.43% | 24.21% | NA |
| Japonica Intermediate | 241 | 22.40% | 0.80% | 20.75% | 56.02% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 75.00% | 4.17% | NA |
| Intermediate | 90 | 65.60% | 0.00% | 15.56% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001343441 | A -> G | LOC_Os10g03180.1 | downstream_gene_variant ; 639.0bp to feature; MODIFIER | silent_mutation | Average:24.767; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg1001343441 | A -> G | LOC_Os10g03190.1 | downstream_gene_variant ; 4320.0bp to feature; MODIFIER | silent_mutation | Average:24.767; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg1001343441 | A -> G | LOC_Os10g03180-LOC_Os10g03190 | intergenic_region ; MODIFIER | silent_mutation | Average:24.767; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg1001343441 | A -> DEL | N | N | silent_mutation | Average:24.767; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001343441 | NA | 7.92E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001343441 | NA | 6.53E-07 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001343441 | 3.50E-06 | 3.50E-06 | mr1418_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001343441 | NA | 2.81E-06 | mr1420_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001343441 | 9.52E-06 | NA | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001343441 | NA | 1.84E-07 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001343441 | NA | 8.63E-06 | mr1488_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001343441 | 2.16E-06 | 2.16E-06 | mr1506_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001343441 | NA | 1.82E-06 | mr1786_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |