\
| Variant ID: vg1001321073 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1321073 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 58. )
ACCTGGGGTTCCTTGAGGCGGGCTTTAGGAACTCGCGGTTGTAGACCGAGCAGATCAATCAACTTGCACAATCATTTGCTCCTCTAGCGGAACGGGTCTT[T/A]
TTATCCATGGACTGGCGATGGCCGTCGTGGTAGATGTAATATCTGCAAAAAACATCTCAAACAAGTTTGTAATATAACAATGTCTGGTTCAACTTTTGTA
TACAAAAGTTGAACCAGACATTGTTATATTACAAACTTGTTTGAGATGTTTTTTGCAGATATTACATCTACCACGACGGCCATCGCCAGTCCATGGATAA[A/T]
AAGACCCGTTCCGCTAGAGGAGCAAATGATTGTGCAAGTTGATTGATCTGCTCGGTCTACAACCGCGAGTTCCTAAAGCCCGCCTCAAGGAACCCCAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.70% | 24.20% | 0.44% | 48.67% | NA |
| All Indica | 2759 | 43.80% | 14.60% | 0.51% | 41.07% | NA |
| All Japonica | 1512 | 2.30% | 39.40% | 0.33% | 57.94% | NA |
| Aus | 269 | 0.70% | 37.50% | 0.00% | 61.71% | NA |
| Indica I | 595 | 60.20% | 3.40% | 0.84% | 35.63% | NA |
| Indica II | 465 | 34.20% | 9.50% | 0.22% | 56.13% | NA |
| Indica III | 913 | 35.50% | 26.30% | 0.22% | 38.01% | NA |
| Indica Intermediate | 786 | 46.80% | 12.60% | 0.76% | 39.82% | NA |
| Temperate Japonica | 767 | 1.20% | 71.20% | 0.26% | 27.38% | NA |
| Tropical Japonica | 504 | 3.80% | 3.00% | 0.20% | 93.06% | NA |
| Japonica Intermediate | 241 | 2.90% | 14.50% | 0.83% | 81.74% | NA |
| VI/Aromatic | 96 | 1.00% | 15.60% | 1.04% | 82.29% | NA |
| Intermediate | 90 | 16.70% | 31.10% | 1.11% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001321073 | T -> A | LOC_Os10g03110.1 | upstream_gene_variant ; 4609.0bp to feature; MODIFIER | silent_mutation | Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| vg1001321073 | T -> A | LOC_Os10g03120.1 | downstream_gene_variant ; 553.0bp to feature; MODIFIER | silent_mutation | Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| vg1001321073 | T -> A | LOC_Os10g03130.1 | downstream_gene_variant ; 935.0bp to feature; MODIFIER | silent_mutation | Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| vg1001321073 | T -> A | LOC_Os10g03140.1 | downstream_gene_variant ; 3786.0bp to feature; MODIFIER | silent_mutation | Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| vg1001321073 | T -> A | LOC_Os10g03120-LOC_Os10g03130 | intergenic_region ; MODIFIER | silent_mutation | Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| vg1001321073 | T -> DEL | N | N | silent_mutation | Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001321073 | NA | 4.06E-12 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001321073 | 4.67E-07 | 6.09E-07 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001321073 | 4.52E-06 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001321073 | 1.45E-06 | 2.45E-06 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001321073 | NA | 3.14E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001321073 | NA | 2.01E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001321073 | NA | 2.41E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001321073 | 6.20E-06 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001321073 | 4.35E-08 | 1.59E-07 | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001321073 | NA | 2.61E-12 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |