Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001321073:

Variant ID: vg1001321073 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1321073
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTGGGGTTCCTTGAGGCGGGCTTTAGGAACTCGCGGTTGTAGACCGAGCAGATCAATCAACTTGCACAATCATTTGCTCCTCTAGCGGAACGGGTCTT[T/A]
TTATCCATGGACTGGCGATGGCCGTCGTGGTAGATGTAATATCTGCAAAAAACATCTCAAACAAGTTTGTAATATAACAATGTCTGGTTCAACTTTTGTA

Reverse complement sequence

TACAAAAGTTGAACCAGACATTGTTATATTACAAACTTGTTTGAGATGTTTTTTGCAGATATTACATCTACCACGACGGCCATCGCCAGTCCATGGATAA[A/T]
AAGACCCGTTCCGCTAGAGGAGCAAATGATTGTGCAAGTTGATTGATCTGCTCGGTCTACAACCGCGAGTTCCTAAAGCCCGCCTCAAGGAACCCCAGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.70%	24.20%	0.44%	48.67%	NA
All Indica	2759	43.80%	14.60%	0.51%	41.07%	NA
All Japonica	1512	2.30%	39.40%	0.33%	57.94%	NA
Aus	269	0.70%	37.50%	0.00%	61.71%	NA
Indica I	595	60.20%	3.40%	0.84%	35.63%	NA
Indica II	465	34.20%	9.50%	0.22%	56.13%	NA
Indica III	913	35.50%	26.30%	0.22%	38.01%	NA
Indica Intermediate	786	46.80%	12.60%	0.76%	39.82%	NA
Temperate Japonica	767	1.20%	71.20%	0.26%	27.38%	NA
Tropical Japonica	504	3.80%	3.00%	0.20%	93.06%	NA
Japonica Intermediate	241	2.90%	14.50%	0.83%	81.74%	NA
VI/Aromatic	96	1.00%	15.60%	1.04%	82.29%	NA
Intermediate	90	16.70%	31.10%	1.11%	51.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001321073	T -> A	LOC_Os10g03110.1	upstream_gene_variant ; 4609.0bp to feature; MODIFIER	silent_mutation	Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397	N	N	N	N
vg1001321073	T -> A	LOC_Os10g03120.1	downstream_gene_variant ; 553.0bp to feature; MODIFIER	silent_mutation	Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397	N	N	N	N
vg1001321073	T -> A	LOC_Os10g03130.1	downstream_gene_variant ; 935.0bp to feature; MODIFIER	silent_mutation	Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397	N	N	N	N
vg1001321073	T -> A	LOC_Os10g03140.1	downstream_gene_variant ; 3786.0bp to feature; MODIFIER	silent_mutation	Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397	N	N	N	N
vg1001321073	T -> A	LOC_Os10g03120-LOC_Os10g03130	intergenic_region ; MODIFIER	silent_mutation	Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397	N	N	N	N
vg1001321073	T -> DEL	N	N	silent_mutation	Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001321073	NA	4.06E-12	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073	4.67E-07	6.09E-07	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073	4.52E-06	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073	1.45E-06	2.45E-06	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073	NA	3.14E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073	NA	2.01E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073	NA	2.41E-09	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073	6.20E-06	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073	4.35E-08	1.59E-07	mr1486_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073	NA	2.61E-12	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251