\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001321073:

Variant ID: vg1001321073 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1321073
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTGGGGTTCCTTGAGGCGGGCTTTAGGAACTCGCGGTTGTAGACCGAGCAGATCAATCAACTTGCACAATCATTTGCTCCTCTAGCGGAACGGGTCTT[T/A]
TTATCCATGGACTGGCGATGGCCGTCGTGGTAGATGTAATATCTGCAAAAAACATCTCAAACAAGTTTGTAATATAACAATGTCTGGTTCAACTTTTGTA

Reverse complement sequence

TACAAAAGTTGAACCAGACATTGTTATATTACAAACTTGTTTGAGATGTTTTTTGCAGATATTACATCTACCACGACGGCCATCGCCAGTCCATGGATAA[A/T]
AAGACCCGTTCCGCTAGAGGAGCAAATGATTGTGCAAGTTGATTGATCTGCTCGGTCTACAACCGCGAGTTCCTAAAGCCCGCCTCAAGGAACCCCAGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.70% 24.20% 0.44% 48.67% NA
All Indica  2759 43.80% 14.60% 0.51% 41.07% NA
All Japonica  1512 2.30% 39.40% 0.33% 57.94% NA
Aus  269 0.70% 37.50% 0.00% 61.71% NA
Indica I  595 60.20% 3.40% 0.84% 35.63% NA
Indica II  465 34.20% 9.50% 0.22% 56.13% NA
Indica III  913 35.50% 26.30% 0.22% 38.01% NA
Indica Intermediate  786 46.80% 12.60% 0.76% 39.82% NA
Temperate Japonica  767 1.20% 71.20% 0.26% 27.38% NA
Tropical Japonica  504 3.80% 3.00% 0.20% 93.06% NA
Japonica Intermediate  241 2.90% 14.50% 0.83% 81.74% NA
VI/Aromatic  96 1.00% 15.60% 1.04% 82.29% NA
Intermediate  90 16.70% 31.10% 1.11% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001321073 T -> A LOC_Os10g03110.1 upstream_gene_variant ; 4609.0bp to feature; MODIFIER silent_mutation Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg1001321073 T -> A LOC_Os10g03120.1 downstream_gene_variant ; 553.0bp to feature; MODIFIER silent_mutation Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg1001321073 T -> A LOC_Os10g03130.1 downstream_gene_variant ; 935.0bp to feature; MODIFIER silent_mutation Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg1001321073 T -> A LOC_Os10g03140.1 downstream_gene_variant ; 3786.0bp to feature; MODIFIER silent_mutation Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg1001321073 T -> A LOC_Os10g03120-LOC_Os10g03130 intergenic_region ; MODIFIER silent_mutation Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg1001321073 T -> DEL N N silent_mutation Average:36.036; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001321073 NA 4.06E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073 4.67E-07 6.09E-07 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073 4.52E-06 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073 1.45E-06 2.45E-06 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073 NA 3.14E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073 NA 2.01E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073 NA 2.41E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073 6.20E-06 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073 4.35E-08 1.59E-07 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001321073 NA 2.61E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251