\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001306734:

Variant ID: vg1001306734 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1306734
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCGTTCAAGATTCTTTACAGACAAAATTAAAGGCGTTTGATGTGAAGAGCTTGGGCTGAGTTTAGTTCCAAACTTTTTCTTTAAACTTTCAACTTTTT[C/T]
ATCACATCAAAATTTTTTTATACACTCAAACATTCAATTTTTCCATCACATCATTTCAATTTCAACCAAACTTTTAATTTTGGCGTGAACTAAACACACC

Reverse complement sequence

GGTGTGTTTAGTTCACGCCAAAATTAAAAGTTTGGTTGAAATTGAAATGATGTGATGGAAAAATTGAATGTTTGAGTGTATAAAAAAATTTTGATGTGAT[G/A]
AAAAAGTTGAAAGTTTAAAGAAAAAGTTTGGAACTAAACTCAGCCCAAGCTCTTCACATCAAACGCCTTTAATTTTGTCTGTAAAGAATCTTGAACGACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.20% 25.50% 0.99% 33.31% NA
All Indica  2759 57.30% 8.40% 1.12% 33.13% NA
All Japonica  1512 8.10% 54.30% 0.66% 36.97% NA
Aus  269 58.40% 35.30% 0.37% 5.95% NA
Indica I  595 62.70% 11.60% 3.03% 22.69% NA
Indica II  465 42.60% 6.70% 1.94% 48.82% NA
Indica III  913 55.50% 8.90% 0.11% 35.49% NA
Indica Intermediate  786 64.00% 6.60% 0.38% 29.01% NA
Temperate Japonica  767 0.90% 85.10% 0.52% 13.43% NA
Tropical Japonica  504 20.00% 15.50% 0.60% 63.89% NA
Japonica Intermediate  241 5.80% 37.30% 1.24% 55.60% NA
VI/Aromatic  96 6.20% 30.20% 3.12% 60.42% NA
Intermediate  90 36.70% 31.10% 2.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001306734 C -> T LOC_Os10g03100.1 upstream_gene_variant ; 1680.0bp to feature; MODIFIER silent_mutation Average:56.59; most accessible tissue: Callus, score: 98.28 N N N N
vg1001306734 C -> T LOC_Os10g03110.1 downstream_gene_variant ; 4790.0bp to feature; MODIFIER silent_mutation Average:56.59; most accessible tissue: Callus, score: 98.28 N N N N
vg1001306734 C -> T LOC_Os10g03090-LOC_Os10g03100 intergenic_region ; MODIFIER silent_mutation Average:56.59; most accessible tissue: Callus, score: 98.28 N N N N
vg1001306734 C -> DEL N N silent_mutation Average:56.59; most accessible tissue: Callus, score: 98.28 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001306734 2.48E-10 2.45E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734 3.13E-11 3.82E-12 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734 1.22E-07 1.93E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734 1.25E-09 1.85E-10 mr1548 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734 NA 1.01E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734 1.27E-06 5.61E-07 mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734 NA 1.08E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734 7.09E-09 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734 1.09E-10 3.03E-11 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001306734 6.86E-10 6.21E-11 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251