\
| Variant ID: vg1001306734 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1306734 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 47. )
AGTCGTTCAAGATTCTTTACAGACAAAATTAAAGGCGTTTGATGTGAAGAGCTTGGGCTGAGTTTAGTTCCAAACTTTTTCTTTAAACTTTCAACTTTTT[C/T]
ATCACATCAAAATTTTTTTATACACTCAAACATTCAATTTTTCCATCACATCATTTCAATTTCAACCAAACTTTTAATTTTGGCGTGAACTAAACACACC
GGTGTGTTTAGTTCACGCCAAAATTAAAAGTTTGGTTGAAATTGAAATGATGTGATGGAAAAATTGAATGTTTGAGTGTATAAAAAAATTTTGATGTGAT[G/A]
AAAAAGTTGAAAGTTTAAAGAAAAAGTTTGGAACTAAACTCAGCCCAAGCTCTTCACATCAAACGCCTTTAATTTTGTCTGTAAAGAATCTTGAACGACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.20% | 25.50% | 0.99% | 33.31% | NA |
| All Indica | 2759 | 57.30% | 8.40% | 1.12% | 33.13% | NA |
| All Japonica | 1512 | 8.10% | 54.30% | 0.66% | 36.97% | NA |
| Aus | 269 | 58.40% | 35.30% | 0.37% | 5.95% | NA |
| Indica I | 595 | 62.70% | 11.60% | 3.03% | 22.69% | NA |
| Indica II | 465 | 42.60% | 6.70% | 1.94% | 48.82% | NA |
| Indica III | 913 | 55.50% | 8.90% | 0.11% | 35.49% | NA |
| Indica Intermediate | 786 | 64.00% | 6.60% | 0.38% | 29.01% | NA |
| Temperate Japonica | 767 | 0.90% | 85.10% | 0.52% | 13.43% | NA |
| Tropical Japonica | 504 | 20.00% | 15.50% | 0.60% | 63.89% | NA |
| Japonica Intermediate | 241 | 5.80% | 37.30% | 1.24% | 55.60% | NA |
| VI/Aromatic | 96 | 6.20% | 30.20% | 3.12% | 60.42% | NA |
| Intermediate | 90 | 36.70% | 31.10% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001306734 | C -> T | LOC_Os10g03100.1 | upstream_gene_variant ; 1680.0bp to feature; MODIFIER | silent_mutation | Average:56.59; most accessible tissue: Callus, score: 98.28 | N | N | N | N |
| vg1001306734 | C -> T | LOC_Os10g03110.1 | downstream_gene_variant ; 4790.0bp to feature; MODIFIER | silent_mutation | Average:56.59; most accessible tissue: Callus, score: 98.28 | N | N | N | N |
| vg1001306734 | C -> T | LOC_Os10g03090-LOC_Os10g03100 | intergenic_region ; MODIFIER | silent_mutation | Average:56.59; most accessible tissue: Callus, score: 98.28 | N | N | N | N |
| vg1001306734 | C -> DEL | N | N | silent_mutation | Average:56.59; most accessible tissue: Callus, score: 98.28 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001306734 | 2.48E-10 | 2.45E-36 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001306734 | 3.13E-11 | 3.82E-12 | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001306734 | 1.22E-07 | 1.93E-23 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001306734 | 1.25E-09 | 1.85E-10 | mr1548 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001306734 | NA | 1.01E-07 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001306734 | 1.27E-06 | 5.61E-07 | mr1588 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001306734 | NA | 1.08E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001306734 | 7.09E-09 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001306734 | 1.09E-10 | 3.03E-11 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001306734 | 6.86E-10 | 6.21E-11 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |