\
| Variant ID: vg1001281495 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1281495 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GACTTGGGCATTTTGAAAATACTACTAGCACTACTAGTTGATTTGCTCACATATAAAAAGAAGTAGAGCACATGCAAGAGTTAAAAACTCCCCCTTAATG[T/C]
GACATGCTCCATTTTCACAAAGAAGAACCAAATGGCAATAAATCCAAAGCATAAGAGCAAATAGGAGCAAATATACAATATGCAAAAGAAGCAACCATGG
CCATGGTTGCTTCTTTTGCATATTGTATATTTGCTCCTATTTGCTCTTATGCTTTGGATTTATTGCCATTTGGTTCTTCTTTGTGAAAATGGAGCATGTC[A/G]
CATTAAGGGGGAGTTTTTAACTCTTGCATGTGCTCTACTTCTTTTTATATGTGAGCAAATCAACTAGTAGTGCTAGTAGTATTTTCAAAATGCCCAAGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.20% | 3.70% | 0.78% | 7.34% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 67.20% | 10.10% | 1.79% | 20.97% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 87.60% | 4.70% | 0.52% | 7.17% | NA |
| Tropical Japonica | 504 | 44.00% | 17.90% | 2.98% | 35.12% | NA |
| Japonica Intermediate | 241 | 50.60% | 10.80% | 3.32% | 35.27% | NA |
| VI/Aromatic | 96 | 55.20% | 15.60% | 5.21% | 23.96% | NA |
| Intermediate | 90 | 91.10% | 1.10% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001281495 | T -> C | LOC_Os10g03070.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.349; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| vg1001281495 | T -> DEL | N | N | silent_mutation | Average:23.349; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001281495 | NA | 1.24E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001281495 | NA | 1.52E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001281495 | 7.43E-07 | NA | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001281495 | 8.21E-07 | NA | mr1913_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001281495 | 7.46E-06 | NA | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |