\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001271744:

Variant ID: vg1001271744 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1271744
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.07, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GCATCTCCCAAATATTAGATGGGCTTTTACATGGCCCACAATATTAGCTAACCGTAGTTTTTTCGATCTATGGTTGCTATAGTATGATCTATTAAATTAA[C/T]
GGACATATGTTTCTAGTTAATGTGAAAGCTCGTAGAAAGTGTCAAATTAGTATAGGTATAGATAGATATACTTTTCTACTATTTTCAGTCAAGATGATCT

Reverse complement sequence

AGATCATCTTGACTGAAAATAGTAGAAAAGTATATCTATCTATACCTATACTAATTTGACACTTTCTACGAGCTTTCACATTAACTAGAAACATATGTCC[G/A]
TTAATTTAATAGATCATACTATAGCAACCATAGATCGAAAAAACTACGGTTAGCTAATATTGTGGGCCATGTAAAAGCCCATCTAATATTTGGGAGATGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.20% 27.40% 0.21% 38.21% NA
All Indica  2759 16.20% 44.50% 0.14% 39.11% NA
All Japonica  1512 56.30% 2.70% 0.40% 40.61% NA
Aus  269 92.60% 1.10% 0.00% 6.32% NA
Indica I  595 10.40% 62.40% 0.00% 27.23% NA
Indica II  465 9.90% 36.10% 0.43% 53.55% NA
Indica III  913 20.30% 35.70% 0.00% 44.03% NA
Indica Intermediate  786 19.60% 46.30% 0.25% 33.84% NA
Temperate Japonica  767 82.30% 1.20% 0.26% 16.30% NA
Tropical Japonica  504 28.40% 5.20% 0.20% 66.27% NA
Japonica Intermediate  241 32.00% 2.50% 1.24% 64.32% NA
VI/Aromatic  96 33.30% 2.10% 0.00% 64.58% NA
Intermediate  90 42.20% 20.00% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001271744 C -> T LOC_Os10g03060.1 upstream_gene_variant ; 2860.0bp to feature; MODIFIER silent_mutation Average:38.567; most accessible tissue: Callus, score: 91.227 N N N N
vg1001271744 C -> T LOC_Os10g03050-LOC_Os10g03060 intergenic_region ; MODIFIER silent_mutation Average:38.567; most accessible tissue: Callus, score: 91.227 N N N N
vg1001271744 C -> DEL N N silent_mutation Average:38.567; most accessible tissue: Callus, score: 91.227 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001271744 NA 3.24E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 8.83E-11 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 6.85E-21 4.40E-18 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 1.25E-08 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 7.26E-17 1.14E-15 mr1548 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 2.18E-11 4.44E-10 mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 NA 3.71E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 NA 6.52E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 3.39E-11 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 3.77E-17 1.59E-13 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 4.80E-07 NA mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001271744 5.37E-17 8.29E-15 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251