Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001263764:

Variant ID: vg1001263764 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1263764
Reference Allele: G	Alternative Allele: T,C
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGCCAACCAGAGGGGGGGGGGGTGAATGGTTGGTATACCCAAAAAGGGAAAACTTTTAGCGGAAATAAAAGTTACCCTCGAAATCGACGGAGTTCGGTC[G/T,C]
GACCGAGATTGATCTGCCGGTCTGACCGCTCGGATGCCGCCGGTCTGACCGTCGGTGAGTCGTCGGTTAGACCGCCGAAACTCGGTGAAACACAAATCGA

Reverse complement sequence

TCGATTTGTGTTTCACCGAGTTTCGGCGGTCTAACCGACGACTCACCGACGGTCAGACCGGCGGCATCCGAGCGGTCAGACCGGCAGATCAATCTCGGTC[C/A,G]
GACCGAACTCCGTCGATTTCGAGGGTAACTTTTATTTCCGCTAAAAGTTTTCCCTTTTTGGGTATACCAACCATTCACCCCCCCCCCCTCTGGTTGGCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.70%	19.70%	13.08%	19.42%	C: 0.11%
All Indica	2759	65.40%	3.40%	15.04%	15.95%	C: 0.18%
All Japonica	1512	9.30%	52.20%	8.93%	29.50%	NA
Aus	269	93.30%	1.50%	2.97%	2.23%	NA
Indica I	595	68.70%	7.70%	13.61%	9.92%	NA
Indica II	465	48.60%	4.70%	16.56%	29.68%	C: 0.43%
Indica III	913	68.10%	0.50%	16.54%	14.57%	C: 0.22%
Indica Intermediate	786	69.60%	2.80%	13.49%	13.99%	C: 0.13%
Temperate Japonica	767	2.50%	81.40%	7.82%	8.34%	NA
Tropical Japonica	504	20.80%	16.50%	5.75%	56.94%	NA
Japonica Intermediate	241	7.10%	34.40%	19.09%	39.42%	NA
VI/Aromatic	96	17.70%	24.00%	47.92%	10.42%	NA
Intermediate	90	45.60%	21.10%	15.56%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001263764	G -> C	LOC_Os10g03040.1	upstream_gene_variant ; 181.0bp to feature; MODIFIER	silent_mutation	Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg1001263764	G -> C	LOC_Os10g03050.1	downstream_gene_variant ; 1521.0bp to feature; MODIFIER	silent_mutation	Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg1001263764	G -> C	LOC_Os10g03040-LOC_Os10g03050	intergenic_region ; MODIFIER	silent_mutation	Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg1001263764	G -> T	LOC_Os10g03040.1	upstream_gene_variant ; 181.0bp to feature; MODIFIER	silent_mutation	Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg1001263764	G -> T	LOC_Os10g03050.1	downstream_gene_variant ; 1521.0bp to feature; MODIFIER	silent_mutation	Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg1001263764	G -> T	LOC_Os10g03040-LOC_Os10g03050	intergenic_region ; MODIFIER	silent_mutation	Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg1001263764	G -> DEL	N	N	silent_mutation	Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001263764	NA	4.77E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	8.38E-08	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.40E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	2.53E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	4.73E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.46E-08	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	8.54E-06	NA	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	9.69E-07	9.68E-07	mr1261	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	4.33E-08	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.10E-38	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	5.39E-13	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	5.38E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.86E-08	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	7.05E-06	1.43E-10	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	5.63E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.20E-09	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.07E-10	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.74E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	5.73E-07	mr1685	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.33E-07	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	7.29E-22	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	7.60E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.60E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	7.75E-07	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	2.04E-33	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	1.55E-08	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	7.99E-09	1.68E-48	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	3.41E-07	5.14E-16	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	3.98E-16	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764	NA	2.76E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251