\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001263764:

Variant ID: vg1001263764 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1263764
Reference Allele: GAlternative Allele: T,C
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGCCAACCAGAGGGGGGGGGGGTGAATGGTTGGTATACCCAAAAAGGGAAAACTTTTAGCGGAAATAAAAGTTACCCTCGAAATCGACGGAGTTCGGTC[G/T,C]
GACCGAGATTGATCTGCCGGTCTGACCGCTCGGATGCCGCCGGTCTGACCGTCGGTGAGTCGTCGGTTAGACCGCCGAAACTCGGTGAAACACAAATCGA

Reverse complement sequence

TCGATTTGTGTTTCACCGAGTTTCGGCGGTCTAACCGACGACTCACCGACGGTCAGACCGGCGGCATCCGAGCGGTCAGACCGGCAGATCAATCTCGGTC[C/A,G]
GACCGAACTCCGTCGATTTCGAGGGTAACTTTTATTTCCGCTAAAAGTTTTCCCTTTTTGGGTATACCAACCATTCACCCCCCCCCCCTCTGGTTGGCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.70% 19.70% 13.08% 19.42% C: 0.11%
All Indica  2759 65.40% 3.40% 15.04% 15.95% C: 0.18%
All Japonica  1512 9.30% 52.20% 8.93% 29.50% NA
Aus  269 93.30% 1.50% 2.97% 2.23% NA
Indica I  595 68.70% 7.70% 13.61% 9.92% NA
Indica II  465 48.60% 4.70% 16.56% 29.68% C: 0.43%
Indica III  913 68.10% 0.50% 16.54% 14.57% C: 0.22%
Indica Intermediate  786 69.60% 2.80% 13.49% 13.99% C: 0.13%
Temperate Japonica  767 2.50% 81.40% 7.82% 8.34% NA
Tropical Japonica  504 20.80% 16.50% 5.75% 56.94% NA
Japonica Intermediate  241 7.10% 34.40% 19.09% 39.42% NA
VI/Aromatic  96 17.70% 24.00% 47.92% 10.42% NA
Intermediate  90 45.60% 21.10% 15.56% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001263764 G -> C LOC_Os10g03040.1 upstream_gene_variant ; 181.0bp to feature; MODIFIER silent_mutation Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001263764 G -> C LOC_Os10g03050.1 downstream_gene_variant ; 1521.0bp to feature; MODIFIER silent_mutation Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001263764 G -> C LOC_Os10g03040-LOC_Os10g03050 intergenic_region ; MODIFIER silent_mutation Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001263764 G -> T LOC_Os10g03040.1 upstream_gene_variant ; 181.0bp to feature; MODIFIER silent_mutation Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001263764 G -> T LOC_Os10g03050.1 downstream_gene_variant ; 1521.0bp to feature; MODIFIER silent_mutation Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001263764 G -> T LOC_Os10g03040-LOC_Os10g03050 intergenic_region ; MODIFIER silent_mutation Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg1001263764 G -> DEL N N silent_mutation Average:30.559; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001263764 NA 4.77E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 8.38E-08 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.40E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 2.53E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 4.73E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.46E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 8.54E-06 NA mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 9.69E-07 9.68E-07 mr1261 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 4.33E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.10E-38 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 5.39E-13 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 5.38E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.86E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 7.05E-06 1.43E-10 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 5.63E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.20E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.07E-10 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.74E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 5.73E-07 mr1685 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.33E-07 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 7.29E-22 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 7.60E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.60E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 7.75E-07 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 2.04E-33 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 1.55E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 7.99E-09 1.68E-48 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 3.41E-07 5.14E-16 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 3.98E-16 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001263764 NA 2.76E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251