Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001249422:

Variant ID: vg1001249422 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1249422
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TCCAATAATATTATGTCCAGAAGGTGGTTCAACTAAAGTCCAAACTTTGTTTCTCTCAAAATTTTCAAGTTCTTCATGCATGGCGTTAATCCACGATTCA[T/C]
CAGTTAATACATGTGACACATCTTTAGGTTCAAAAGAAGCAACAAATGCAGAATTTGCACAAACATCATGAGTCGTTACCTTAGACCTTGTAGTCCGCTC

Reverse complement sequence

GAGCGGACTACAAGGTCTAAGGTAACGACTCATGATGTTTGTGCAAATTCTGCATTTGTTGCTTCTTTTGAACCTAAAGATGTGTCACATGTATTAACTG[A/G]
TGAATCGTGGATTAACGCCATGCATGAAGAACTTGAAAATTTTGAGAGAAACAAAGTTTGGACTTTAGTTGAACCACCTTCTGGACATAATATTATTGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.00%	26.00%	7.15%	34.81%	NA
All Indica	2759	19.00%	43.20%	11.27%	26.53%	NA
All Japonica	1512	44.50%	1.70%	0.79%	53.04%	NA
Aus	269	97.00%	1.10%	1.12%	0.74%	NA
Indica I	595	2.20%	58.70%	6.05%	33.11%	NA
Indica II	465	8.00%	32.70%	9.03%	50.32%	NA
Indica III	913	33.70%	36.50%	17.85%	11.94%	NA
Indica Intermediate	786	21.10%	45.50%	8.91%	24.43%	NA
Temperate Japonica	767	71.30%	0.50%	0.52%	27.64%	NA
Tropical Japonica	504	17.90%	3.00%	1.19%	77.98%	NA
Japonica Intermediate	241	14.90%	2.50%	0.83%	81.74%	NA
VI/Aromatic	96	16.70%	0.00%	4.17%	79.17%	NA
Intermediate	90	42.20%	12.20%	8.89%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001249422	T -> C	LOC_Os10g02990.1	upstream_gene_variant ; 3762.0bp to feature; MODIFIER	silent_mutation	Average:23.609; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1001249422	T -> C	LOC_Os10g03000.1	upstream_gene_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:23.609; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1001249422	T -> C	LOC_Os10g03020.1	upstream_gene_variant ; 4141.0bp to feature; MODIFIER	silent_mutation	Average:23.609; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1001249422	T -> C	LOC_Os10g03010.1	downstream_gene_variant ; 1280.0bp to feature; MODIFIER	silent_mutation	Average:23.609; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1001249422	T -> C	LOC_Os10g03000-LOC_Os10g03010	intergenic_region ; MODIFIER	silent_mutation	Average:23.609; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1001249422	T -> DEL	N	N	silent_mutation	Average:23.609; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001249422	NA	5.71E-07	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001249422	5.18E-07	NA	mr1971_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001249422	9.79E-07	1.15E-09	mr1971_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251