\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001247868:

Variant ID: vg1001247868 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1247868
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATACAAGCTATGCTAGAGACAAATAAACCTTCAAAGTATTGCTAGCATGCACAAGAAAATACTATATGTATAAACAAAGCTCTCTTTTTCTCAATTTT[C/T]
CTCATTGTTATATTATTGCTTGATAAAACCATGAGGTACAAACTCCCCCTCAAAACATGCCAAAAGGATGAATTATGCCCAATTCACCACGAAGAAAAGC

Reverse complement sequence

GCTTTTCTTCGTGGTGAATTGGGCATAATTCATCCTTTTGGCATGTTTTGAGGGGGAGTTTGTACCTCATGGTTTTATCAAGCAATAATATAACAATGAG[G/A]
AAAATTGAGAAAAAGAGAGCTTTGTTTATACATATAGTATTTTCTTGTGCATGCTAGCAATACTTTGAAGGTTTATTTGTCTCTAGCATAGCTTGTATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 1.80% 13.08% 21.39% NA
All Indica  2759 73.90% 0.00% 11.53% 14.53% NA
All Japonica  1512 47.20% 0.00% 15.15% 37.63% NA
Aus  269 68.40% 30.90% 0.00% 0.74% NA
Indica I  595 64.20% 0.00% 12.61% 23.19% NA
Indica II  465 59.80% 0.00% 14.84% 25.38% NA
Indica III  913 86.60% 0.00% 8.54% 4.82% NA
Indica Intermediate  786 74.80% 0.10% 12.21% 12.85% NA
Temperate Japonica  767 72.80% 0.00% 4.17% 23.08% NA
Tropical Japonica  504 22.00% 0.00% 24.01% 53.97% NA
Japonica Intermediate  241 18.70% 0.00% 31.54% 49.79% NA
VI/Aromatic  96 17.70% 1.00% 55.21% 26.04% NA
Intermediate  90 62.20% 2.20% 20.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001247868 C -> T LOC_Os10g02990.1 upstream_gene_variant ; 2208.0bp to feature; MODIFIER silent_mutation Average:33.085; most accessible tissue: Minghui63 flag leaf, score: 76.453 N N N N
vg1001247868 C -> T LOC_Os10g03000.1 downstream_gene_variant ; 50.0bp to feature; MODIFIER silent_mutation Average:33.085; most accessible tissue: Minghui63 flag leaf, score: 76.453 N N N N
vg1001247868 C -> T LOC_Os10g03010.1 downstream_gene_variant ; 2834.0bp to feature; MODIFIER silent_mutation Average:33.085; most accessible tissue: Minghui63 flag leaf, score: 76.453 N N N N
vg1001247868 C -> T LOC_Os10g02990-LOC_Os10g03000 intergenic_region ; MODIFIER silent_mutation Average:33.085; most accessible tissue: Minghui63 flag leaf, score: 76.453 N N N N
vg1001247868 C -> DEL N N silent_mutation Average:33.085; most accessible tissue: Minghui63 flag leaf, score: 76.453 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001247868 4.77E-06 6.39E-09 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 NA 1.88E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 NA 4.53E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 6.00E-06 4.96E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 NA 7.88E-08 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 3.83E-07 3.83E-07 mr1159_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 6.40E-06 6.39E-06 mr1184_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 4.15E-06 4.14E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 2.28E-06 2.28E-06 mr1374_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 1.55E-06 1.55E-06 mr1412_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 4.14E-06 4.13E-06 mr1466_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 7.05E-06 9.59E-07 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 NA 1.94E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 3.73E-06 3.73E-06 mr1506_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 3.27E-06 3.29E-07 mr1556_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 3.33E-06 3.33E-06 mr1663_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 2.91E-06 6.72E-07 mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 NA 5.27E-06 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 3.81E-06 3.81E-06 mr1687_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 8.25E-06 8.25E-06 mr1688_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 6.78E-07 4.62E-08 mr1689_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 2.99E-06 5.15E-08 mr1738_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 2.05E-06 2.21E-07 mr1764_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 NA 4.95E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 4.46E-07 4.46E-07 mr1811_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 1.44E-06 7.93E-08 mr1812_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 NA 2.39E-06 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 2.00E-06 1.99E-06 mr1832_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 7.89E-06 5.28E-07 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 2.81E-06 2.81E-06 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 1.02E-06 1.02E-06 mr1847_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 NA 8.09E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247868 NA 8.09E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251