\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001247771:

Variant ID: vg1001247771 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1247771
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCAACATTGCATATTTGCTTAATTCAAGTAGAATTTAAGTGTCATGCATCATCTCCTTAAAAGCAAAATCTAAATCTTATGAAAAAGACTAGAATACA[T/C]
ACAAGCTATGCTAGAGACAAATAAACCTTCAAAGTATTGCTAGCATGCACAAGAAAATACTATATGTATAAACAAAGCTCTCTTTTTCTCAATTTTCCTC

Reverse complement sequence

GAGGAAAATTGAGAAAAAGAGAGCTTTGTTTATACATATAGTATTTTCTTGTGCATGCTAGCAATACTTTGAAGGTTTATTTGTCTCTAGCATAGCTTGT[A/G]
TGTATTCTAGTCTTTTTCATAAGATTTAGATTTTGCTTTTAAGGAGATGATGCATGACACTTAAATTCTACTTGAATTAAGCAAATATGCAATGTTGATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 1.90% 9.46% 19.95% NA
All Indica  2759 74.80% 0.30% 9.28% 15.66% NA
All Japonica  1512 55.40% 3.20% 9.46% 31.94% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 64.50% 0.00% 10.08% 25.38% NA
Indica II  465 61.10% 0.00% 12.04% 26.88% NA
Indica III  913 86.60% 0.90% 7.01% 5.48% NA
Indica Intermediate  786 76.80% 0.00% 9.67% 13.49% NA
Temperate Japonica  767 74.30% 2.10% 4.30% 19.30% NA
Tropical Japonica  504 37.30% 3.00% 12.70% 47.02% NA
Japonica Intermediate  241 33.20% 7.10% 19.09% 40.66% NA
VI/Aromatic  96 18.80% 30.20% 35.42% 15.62% NA
Intermediate  90 66.70% 5.60% 15.56% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001247771 T -> C LOC_Os10g02990.1 upstream_gene_variant ; 2111.0bp to feature; MODIFIER silent_mutation Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 N N N N
vg1001247771 T -> C LOC_Os10g03000.1 downstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 N N N N
vg1001247771 T -> C LOC_Os10g03010.1 downstream_gene_variant ; 2931.0bp to feature; MODIFIER silent_mutation Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 N N N N
vg1001247771 T -> C LOC_Os10g02990-LOC_Os10g03000 intergenic_region ; MODIFIER silent_mutation Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 N N N N
vg1001247771 T -> DEL N N silent_mutation Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001247771 3.64E-06 NA mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771 NA 6.42E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771 7.39E-08 7.35E-08 mr1197_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771 3.05E-07 3.05E-07 mr1197_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771 NA 2.97E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771 1.93E-06 NA mr1543_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771 8.30E-09 NA mr1680_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771 1.55E-06 NA mr1680_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001247771 1.33E-07 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251