\
| Variant ID: vg1001247771 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1247771 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATCAACATTGCATATTTGCTTAATTCAAGTAGAATTTAAGTGTCATGCATCATCTCCTTAAAAGCAAAATCTAAATCTTATGAAAAAGACTAGAATACA[T/C]
ACAAGCTATGCTAGAGACAAATAAACCTTCAAAGTATTGCTAGCATGCACAAGAAAATACTATATGTATAAACAAAGCTCTCTTTTTCTCAATTTTCCTC
GAGGAAAATTGAGAAAAAGAGAGCTTTGTTTATACATATAGTATTTTCTTGTGCATGCTAGCAATACTTTGAAGGTTTATTTGTCTCTAGCATAGCTTGT[A/G]
TGTATTCTAGTCTTTTTCATAAGATTTAGATTTTGCTTTTAAGGAGATGATGCATGACACTTAAATTCTACTTGAATTAAGCAAATATGCAATGTTGATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 1.90% | 9.46% | 19.95% | NA |
| All Indica | 2759 | 74.80% | 0.30% | 9.28% | 15.66% | NA |
| All Japonica | 1512 | 55.40% | 3.20% | 9.46% | 31.94% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 64.50% | 0.00% | 10.08% | 25.38% | NA |
| Indica II | 465 | 61.10% | 0.00% | 12.04% | 26.88% | NA |
| Indica III | 913 | 86.60% | 0.90% | 7.01% | 5.48% | NA |
| Indica Intermediate | 786 | 76.80% | 0.00% | 9.67% | 13.49% | NA |
| Temperate Japonica | 767 | 74.30% | 2.10% | 4.30% | 19.30% | NA |
| Tropical Japonica | 504 | 37.30% | 3.00% | 12.70% | 47.02% | NA |
| Japonica Intermediate | 241 | 33.20% | 7.10% | 19.09% | 40.66% | NA |
| VI/Aromatic | 96 | 18.80% | 30.20% | 35.42% | 15.62% | NA |
| Intermediate | 90 | 66.70% | 5.60% | 15.56% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001247771 | T -> C | LOC_Os10g02990.1 | upstream_gene_variant ; 2111.0bp to feature; MODIFIER | silent_mutation | Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 | N | N | N | N |
| vg1001247771 | T -> C | LOC_Os10g03000.1 | downstream_gene_variant ; 147.0bp to feature; MODIFIER | silent_mutation | Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 | N | N | N | N |
| vg1001247771 | T -> C | LOC_Os10g03010.1 | downstream_gene_variant ; 2931.0bp to feature; MODIFIER | silent_mutation | Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 | N | N | N | N |
| vg1001247771 | T -> C | LOC_Os10g02990-LOC_Os10g03000 | intergenic_region ; MODIFIER | silent_mutation | Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 | N | N | N | N |
| vg1001247771 | T -> DEL | N | N | silent_mutation | Average:30.161; most accessible tissue: Minghui63 flower, score: 66.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001247771 | 3.64E-06 | NA | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247771 | NA | 6.42E-06 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247771 | 7.39E-08 | 7.35E-08 | mr1197_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247771 | 3.05E-07 | 3.05E-07 | mr1197_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247771 | NA | 2.97E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247771 | 1.93E-06 | NA | mr1543_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247771 | 8.30E-09 | NA | mr1680_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247771 | 1.55E-06 | NA | mr1680_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001247771 | 1.33E-07 | NA | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |