| Variant ID: vg1001245650 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1245650 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.11, others allele: 0.00, population size: 36. )
AGGCAAGTGTCCTGAAAATTGGTTATTATCAAGCCAAAGGTCTGGTATGCCCGTGAGATTTTCGAATTCCCGAGGAAGAGAACCTGTTAATCGGTTATGA[A/G]
ACATGGTCATCAGTTGGATGTTCACCAAGTTACCGAAAGTTTTGTAGCATCGAATCACAATAACTAAGACAACCAGGGGGGGAGGGGTGAATGGTTAGTA
TACTAACCATTCACCCCTCCCCCCCTGGTTGTCTTAGTTATTGTGATTCGATGCTACAAAACTTTCGGTAACTTGGTGAACATCCAACTGATGACCATGT[T/C]
TCATAACCGATTAACAGGTTCTCTTCCTCGGGAATTCGAAAATCTCACGGGCATACCAGACCTTTGGCTTGATAATAACCAATTTTCAGGACACTTGCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.30% | 16.00% | 5.69% | 24.02% | NA |
| All Indica | 2759 | 68.70% | 19.10% | 6.85% | 5.36% | NA |
| All Japonica | 1512 | 41.30% | 3.80% | 1.79% | 53.17% | NA |
| Aus | 269 | 3.30% | 52.80% | 15.24% | 28.62% | NA |
| Indica I | 595 | 98.20% | 1.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 60.40% | 21.50% | 15.48% | 2.58% | NA |
| Indica III | 913 | 54.90% | 30.40% | 7.01% | 7.67% | NA |
| Indica Intermediate | 786 | 67.40% | 17.70% | 6.49% | 8.40% | NA |
| Temperate Japonica | 767 | 72.10% | 0.70% | 0.52% | 26.73% | NA |
| Tropical Japonica | 504 | 6.00% | 9.10% | 3.57% | 81.35% | NA |
| Japonica Intermediate | 241 | 17.00% | 2.50% | 2.07% | 78.42% | NA |
| VI/Aromatic | 96 | 6.20% | 11.50% | 4.17% | 78.12% | NA |
| Intermediate | 90 | 35.60% | 21.10% | 8.89% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001245650 | A -> G | LOC_Os10g02990.1 | missense_variant ; p.Phe4Ser; MODERATE | nonsynonymous_codon ; F4A | Average:39.81; most accessible tissue: Minghui63 panicle, score: 64.459 | unknown | unknown | TOLERATED | 0.06 |
| vg1001245650 | A -> G | LOC_Os10g02990.1 | missense_variant ; p.Phe4Ser; MODERATE | nonsynonymous_codon ; F4S | Average:39.81; most accessible tissue: Minghui63 panicle, score: 64.459 | unknown | unknown | TOLERATED | 0.11 |
| vg1001245650 | A -> DEL | LOC_Os10g02990.1 | N | frameshift_variant | Average:39.81; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001245650 | 6.30E-15 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001245650 | 1.26E-18 | 1.95E-16 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001245650 | 7.49E-16 | NA | mr1548 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001245650 | 3.59E-17 | 9.25E-16 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001245650 | 1.87E-06 | NA | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001245650 | 7.60E-09 | 4.34E-07 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001245650 | 2.04E-18 | NA | mr1486_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001245650 | 6.02E-23 | 8.32E-21 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001245650 | 1.63E-12 | NA | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001245650 | 8.05E-17 | 6.24E-10 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |