\
| Variant ID: vg1001244483 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1244483 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 232. )
GTAGACCTTGCCAGATCCTCCTATTCCAACGATGTGCTTATCATTGAAGTTTTCGGTTGCCCTGATGATATCCTCAAATGCTAGTCTGCCATCGAAGTTC[T/C,A]
AGACAGAAAACATGTTCCTTGCAACAGTAATAGCACTAGCGCTTTGCTGTTGTTTTCTCTTGTTATGAACAAGCTTTGTGATGACAATAATTGTAGCCAG
CTGGCTACAATTATTGTCATCACAAAGCTTGTTCATAACAAGAGAAAACAACAGCAAAGCGCTAGTGCTATTACTGTTGCAAGGAACATGTTTTCTGTCT[A/G,T]
GAACTTCGATGGCAGACTAGCATTTGAGGATATCATCAGGGCAACCGAAAACTTCAATGATAAGCACATCGTTGGAATAGGAGGATCTGGCAAGGTCTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.10% | 15.60% | 2.62% | 44.54% | A: 0.15% |
| All Indica | 2759 | 51.50% | 4.50% | 1.78% | 41.97% | A: 0.25% |
| All Japonica | 1512 | 6.90% | 38.80% | 3.51% | 50.86% | NA |
| Aus | 269 | 65.40% | 4.10% | 4.83% | 25.65% | NA |
| Indica I | 595 | 43.00% | 1.80% | 2.52% | 52.61% | NA |
| Indica II | 465 | 65.60% | 1.70% | 1.51% | 31.18% | NA |
| Indica III | 913 | 52.40% | 7.40% | 0.99% | 38.55% | A: 0.66% |
| Indica Intermediate | 786 | 48.70% | 4.60% | 2.29% | 44.27% | A: 0.13% |
| Temperate Japonica | 767 | 1.30% | 70.80% | 2.35% | 25.55% | NA |
| Tropical Japonica | 504 | 16.30% | 2.40% | 4.96% | 76.39% | NA |
| Japonica Intermediate | 241 | 5.00% | 12.90% | 4.15% | 78.01% | NA |
| VI/Aromatic | 96 | 8.30% | 7.30% | 7.29% | 77.08% | NA |
| Intermediate | 90 | 45.60% | 13.30% | 2.22% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001244483 | T -> C | LOC_Os10g02990.1 | splice_acceptor_variant&intron_variant ; HIGH | splice_acceptor_variant | Average:31.27; most accessible tissue: Callus, score: 84.021 | N | N | N | N |
| vg1001244483 | T -> A | LOC_Os10g02990.1 | splice_acceptor_variant&intron_variant ; HIGH | splice_acceptor_variant | Average:31.27; most accessible tissue: Callus, score: 84.021 | N | N | N | N |
| vg1001244483 | T -> DEL | LOC_Os10g02990.1 | N | splice_acceptor_variant | Average:31.27; most accessible tissue: Callus, score: 84.021 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001244483 | 1.13E-07 | 3.15E-36 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001244483 | 3.13E-12 | 3.89E-10 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001244483 | 1.27E-07 | 1.80E-25 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001244483 | 1.44E-11 | 6.30E-10 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001244483 | NA | 9.58E-22 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001244483 | 8.71E-09 | 7.28E-07 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001244483 | 1.86E-08 | 1.24E-49 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001244483 | 1.19E-14 | 2.65E-12 | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001244483 | 2.09E-09 | 4.51E-28 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001244483 | 3.17E-16 | 1.53E-10 | mr1588_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |