\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001244483:

Variant ID: vg1001244483 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1244483
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGACCTTGCCAGATCCTCCTATTCCAACGATGTGCTTATCATTGAAGTTTTCGGTTGCCCTGATGATATCCTCAAATGCTAGTCTGCCATCGAAGTTC[T/C,A]
AGACAGAAAACATGTTCCTTGCAACAGTAATAGCACTAGCGCTTTGCTGTTGTTTTCTCTTGTTATGAACAAGCTTTGTGATGACAATAATTGTAGCCAG

Reverse complement sequence

CTGGCTACAATTATTGTCATCACAAAGCTTGTTCATAACAAGAGAAAACAACAGCAAAGCGCTAGTGCTATTACTGTTGCAAGGAACATGTTTTCTGTCT[A/G,T]
GAACTTCGATGGCAGACTAGCATTTGAGGATATCATCAGGGCAACCGAAAACTTCAATGATAAGCACATCGTTGGAATAGGAGGATCTGGCAAGGTCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 15.60% 2.62% 44.54% A: 0.15%
All Indica  2759 51.50% 4.50% 1.78% 41.97% A: 0.25%
All Japonica  1512 6.90% 38.80% 3.51% 50.86% NA
Aus  269 65.40% 4.10% 4.83% 25.65% NA
Indica I  595 43.00% 1.80% 2.52% 52.61% NA
Indica II  465 65.60% 1.70% 1.51% 31.18% NA
Indica III  913 52.40% 7.40% 0.99% 38.55% A: 0.66%
Indica Intermediate  786 48.70% 4.60% 2.29% 44.27% A: 0.13%
Temperate Japonica  767 1.30% 70.80% 2.35% 25.55% NA
Tropical Japonica  504 16.30% 2.40% 4.96% 76.39% NA
Japonica Intermediate  241 5.00% 12.90% 4.15% 78.01% NA
VI/Aromatic  96 8.30% 7.30% 7.29% 77.08% NA
Intermediate  90 45.60% 13.30% 2.22% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001244483 T -> C LOC_Os10g02990.1 splice_acceptor_variant&intron_variant ; HIGH splice_acceptor_variant Average:31.27; most accessible tissue: Callus, score: 84.021 N N N N
vg1001244483 T -> A LOC_Os10g02990.1 splice_acceptor_variant&intron_variant ; HIGH splice_acceptor_variant Average:31.27; most accessible tissue: Callus, score: 84.021 N N N N
vg1001244483 T -> DEL LOC_Os10g02990.1 N splice_acceptor_variant Average:31.27; most accessible tissue: Callus, score: 84.021 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001244483 1.13E-07 3.15E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001244483 3.13E-12 3.89E-10 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001244483 1.27E-07 1.80E-25 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001244483 1.44E-11 6.30E-10 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001244483 NA 9.58E-22 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001244483 8.71E-09 7.28E-07 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001244483 1.86E-08 1.24E-49 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001244483 1.19E-14 2.65E-12 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001244483 2.09E-09 4.51E-28 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001244483 3.17E-16 1.53E-10 mr1588_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251