Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001242224:

Variant ID: vg1001242224 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1242224
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, G: 0.28, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

ACTGATGTAGAAGCTACAAAGTTAGTACACAATAGTTGCCCTTAATCACCACATAACAAGCCGCCTAGGTGTACAATTGAGCATTATCATGAAATATGAA[C/G]
CAGTACATTAATTCCTATTTTGAATATGATCGTCTTCTCCCGCTGATTCTTTCACCGTATTTCTGATACATATCTAACTATAATTGAACAAGTTTGTCAT

Reverse complement sequence

ATGACAAACTTGTTCAATTATAGTTAGATATGTATCAGAAATACGGTGAAAGAATCAGCGGGAGAAGACGATCATATTCAAAATAGGAATTAATGTACTG[G/C]
TTCATATTTCATGATAATGCTCAATTGTACACCTAGGCGGCTTGTTATGTGGTGATTAAGGGCAACTATTGTGTACTAACTTTGTAGCTTCTACATCAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	47.20%	0.06%	0.00%	NA
All Indica	2759	76.50%	23.50%	0.04%	0.00%	NA
All Japonica	1512	6.30%	93.70%	0.00%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	62.40%	37.60%	0.00%	0.00%	NA
Indica III	913	69.00%	31.00%	0.00%	0.00%	NA
Indica Intermediate	786	77.60%	22.30%	0.13%	0.00%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	17.10%	82.90%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	93.80%	1.04%	0.00%	NA
Intermediate	90	30.00%	68.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001242224	C -> G	LOC_Os10g02980.1	downstream_gene_variant ; 452.0bp to feature; MODIFIER	silent_mutation	Average:69.969; most accessible tissue: Callus, score: 96.279	N	N	N	N
vg1001242224	C -> G	LOC_Os10g02990.1	downstream_gene_variant ; 1254.0bp to feature; MODIFIER	silent_mutation	Average:69.969; most accessible tissue: Callus, score: 96.279	N	N	N	N
vg1001242224	C -> G	LOC_Os10g02980-LOC_Os10g02990	intergenic_region ; MODIFIER	silent_mutation	Average:69.969; most accessible tissue: Callus, score: 96.279	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001242224	3.63E-09	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	2.85E-12	2.91E-11	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	NA	3.65E-25	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	7.86E-08	3.89E-24	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	9.57E-10	1.66E-08	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	NA	5.21E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	1.66E-07	1.48E-07	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	NA	1.54E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	NA	3.90E-27	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	3.45E-10	8.58E-52	mr1486_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	3.57E-14	2.72E-17	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	NA	1.00E-22	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	1.02E-06	3.77E-25	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	2.82E-09	8.11E-09	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	NA	3.11E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	NA	7.65E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	NA	4.45E-13	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001242224	NA	5.00E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251