\
| Variant ID: vg1001229450 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1229450 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 127. )
TTACATAACGTTTGACCATTCGTTTTATTCATAAATATATAAAGTATAAGCATGTGAAATTACAAGTTAAGATTATAGTTTTTTTATTACAGTATAAAAT[A/T]
AGTTATAATATATATTTTGAATAAGATGAATGATCAACGTCAAAGTCAGCGAAGTCATTACTTTTGAAAACGGAGGTAGTACTACTAGCTTATACAAACA
TGTTTGTATAAGCTAGTAGTACTACCTCCGTTTTCAAAAGTAATGACTTCGCTGACTTTGACGTTGATCATTCATCTTATTCAAAATATATATTATAACT[T/A]
ATTTTATACTGTAATAAAAAAACTATAATCTTAACTTGTAATTTCACATGCTTATACTTTATATATTTATGAATAAAACGAATGGTCAAACGTTATGTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 5.00% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 8.40% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 73.10% | 25.80% | 1.08% | 0.00% | NA |
| Indica III | 913 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.10% | 7.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001229450 | A -> T | LOC_Os10g02970.1 | upstream_gene_variant ; 2389.0bp to feature; MODIFIER | silent_mutation | Average:76.075; most accessible tissue: Callus, score: 95.593 | N | N | N | N |
| vg1001229450 | A -> T | LOC_Os10g02980.1 | upstream_gene_variant ; 4617.0bp to feature; MODIFIER | silent_mutation | Average:76.075; most accessible tissue: Callus, score: 95.593 | N | N | N | N |
| vg1001229450 | A -> T | LOC_Os10g02970-LOC_Os10g02980 | intergenic_region ; MODIFIER | silent_mutation | Average:76.075; most accessible tissue: Callus, score: 95.593 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001229450 | 1.02E-16 | NA | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | 2.43E-19 | 6.94E-16 | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | 1.04E-15 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | 1.91E-15 | 5.22E-12 | mr1548 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | 9.75E-11 | NA | mr1588 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | 1.47E-12 | 7.08E-13 | mr1588 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | NA | 4.48E-08 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | NA | 1.43E-08 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | 2.23E-17 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | 2.14E-20 | 6.81E-21 | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | 1.68E-15 | NA | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001229450 | 5.92E-17 | 1.54E-18 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |