\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001229450:

Variant ID: vg1001229450 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1229450
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


TTACATAACGTTTGACCATTCGTTTTATTCATAAATATATAAAGTATAAGCATGTGAAATTACAAGTTAAGATTATAGTTTTTTTATTACAGTATAAAAT[A/T]
AGTTATAATATATATTTTGAATAAGATGAATGATCAACGTCAAAGTCAGCGAAGTCATTACTTTTGAAAACGGAGGTAGTACTACTAGCTTATACAAACA

Reverse complement sequence

TGTTTGTATAAGCTAGTAGTACTACCTCCGTTTTCAAAAGTAATGACTTCGCTGACTTTGACGTTGATCATTCATCTTATTCAAAATATATATTATAACT[T/A]
ATTTTATACTGTAATAAAAAAACTATAATCTTAACTTGTAATTTCACATGCTTATACTTTATATATTTATGAATAAAACGAATGGTCAAACGTTATGTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.00% 0.15% 0.00% NA
All Indica  2759 91.40% 8.40% 0.25% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 73.10% 25.80% 1.08% 0.00% NA
Indica III  913 95.30% 4.70% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.60% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001229450 A -> T LOC_Os10g02970.1 upstream_gene_variant ; 2389.0bp to feature; MODIFIER silent_mutation Average:76.075; most accessible tissue: Callus, score: 95.593 N N N N
vg1001229450 A -> T LOC_Os10g02980.1 upstream_gene_variant ; 4617.0bp to feature; MODIFIER silent_mutation Average:76.075; most accessible tissue: Callus, score: 95.593 N N N N
vg1001229450 A -> T LOC_Os10g02970-LOC_Os10g02980 intergenic_region ; MODIFIER silent_mutation Average:76.075; most accessible tissue: Callus, score: 95.593 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001229450 1.02E-16 NA mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 2.43E-19 6.94E-16 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 1.04E-15 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 1.91E-15 5.22E-12 mr1548 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 9.75E-11 NA mr1588 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 1.47E-12 7.08E-13 mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 NA 4.48E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 NA 1.43E-08 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 2.23E-17 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 2.14E-20 6.81E-21 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 1.68E-15 NA mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001229450 5.92E-17 1.54E-18 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251