\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001225032:

Variant ID: vg1001225032 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1225032
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.04, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTTATTGTATGACGCATCAAGTGTTGATAGGCTCACCATGCTTGCAAAGGAAGTCGGAATTCTTCCAGTGAACTGGTTGTGAGATAAATTTAGAAAT[A/T]
CCAGCATCTGCATCCTTCCAAAGTCTTGCGGCAACAAACCATCAAGTTTGTTATTGCTAACATCTAGCATGATTTGTATGCTTGCTAAATTTCCAATTGT

Reverse complement sequence

ACAATTGGAAATTTAGCAAGCATACAAATCATGCTAGATGTTAGCAATAACAAACTTGATGGTTTGTTGCCGCAAGACTTTGGAAGGATGCAGATGCTGG[T/A]
ATTTCTAAATTTATCTCACAACCAGTTCACTGGAAGAATTCCGACTTCCTTTGCAAGCATGGTGAGCCTATCAACACTTGATGCGTCATACAATAACTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 40.30% 0.04% 0.00% NA
All Indica  2759 87.70% 12.30% 0.07% 0.00% NA
All Japonica  1512 6.60% 93.40% 0.00% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 67.30% 32.70% 0.00% 0.00% NA
Indica III  913 92.60% 7.40% 0.00% 0.00% NA
Indica Intermediate  786 86.10% 13.70% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 17.70% 82.30% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 44.40% 55.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001225032 A -> T LOC_Os10g02960.1 upstream_gene_variant ; 2829.0bp to feature; MODIFIER silent_mutation Average:51.182; most accessible tissue: Callus, score: 73.503 N N N N
vg1001225032 A -> T LOC_Os10g02970.1 intron_variant ; MODIFIER silent_mutation Average:51.182; most accessible tissue: Callus, score: 73.503 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001225032 NA 3.92E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 2.29E-08 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 5.62E-11 5.08E-10 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 2.81E-07 7.07E-24 mr1548 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 4.31E-09 1.23E-07 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 5.81E-06 5.14E-22 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 5.43E-08 1.56E-08 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 NA 7.51E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 NA 1.18E-25 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 NA 1.31E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 NA 1.45E-08 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 3.72E-09 2.53E-51 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 3.51E-12 7.28E-15 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 5.98E-08 2.53E-29 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 4.07E-10 1.20E-11 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 NA 2.09E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001225032 NA 4.42E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251