\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001190961:

Variant ID: vg1001190961 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1190961
Reference Allele: GAlternative Allele: T,C
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTCTCATCTACTACCTCCGTCCCAAAATAATTGCAATTCTATGTTATTTAGCATATATTAAGGTTTGAAAGAAAGACTACGGTGCCCCTCATTAAAT[G/T,C]
GTGTTTATGTGAGAGTGGGAAGATGGTTGAGGGTAAAATAGGGAGAAATTTGAATGAGATATGATTGATGGGGCAATTAGTACTCTAGAATTACAATTAT

Reverse complement sequence

ATAATTGTAATTCTAGAGTACTAATTGCCCCATCAATCATATCTCATTCAAATTTCTCCCTATTTTACCCTCAACCATCTTCCCACTCTCACATAAACAC[C/A,G]
ATTTAATGAGGGGCACCGTAGTCTTTCTTTCAAACCTTAATATATGCTAAATAACATAGAATTGCAATTATTTTGGGACGGAGGTAGTAGATGAGAATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 21.10% 0.25% 0.70% C: 0.04%
All Indica  2759 97.40% 1.70% 0.14% 0.69% NA
All Japonica  1512 44.10% 55.40% 0.40% 0.13% NA
Aus  269 97.40% 0.70% 0.00% 1.86% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 97.70% 0.40% 0.00% 1.86% NA
Indica Intermediate  786 95.40% 3.80% 0.51% 0.25% NA
Temperate Japonica  767 70.30% 29.60% 0.13% 0.00% NA
Tropical Japonica  504 18.80% 80.80% 0.40% 0.00% NA
Japonica Intermediate  241 13.70% 84.20% 1.24% 0.83% NA
VI/Aromatic  96 9.40% 83.30% 0.00% 7.29% NA
Intermediate  90 64.40% 31.10% 2.22% 0.00% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001190961 G -> C LOC_Os10g02910.1 upstream_gene_variant ; 1862.0bp to feature; MODIFIER silent_mutation Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199 N N N N
vg1001190961 G -> C LOC_Os10g02930.1 downstream_gene_variant ; 2272.0bp to feature; MODIFIER silent_mutation Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199 N N N N
vg1001190961 G -> C LOC_Os10g02930.2 downstream_gene_variant ; 1838.0bp to feature; MODIFIER silent_mutation Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199 N N N N
vg1001190961 G -> C LOC_Os10g02920.1 intron_variant ; MODIFIER silent_mutation Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199 N N N N
vg1001190961 G -> T LOC_Os10g02910.1 upstream_gene_variant ; 1862.0bp to feature; MODIFIER silent_mutation Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199 N N N N
vg1001190961 G -> T LOC_Os10g02930.1 downstream_gene_variant ; 2272.0bp to feature; MODIFIER silent_mutation Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199 N N N N
vg1001190961 G -> T LOC_Os10g02930.2 downstream_gene_variant ; 1838.0bp to feature; MODIFIER silent_mutation Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199 N N N N
vg1001190961 G -> T LOC_Os10g02920.1 intron_variant ; MODIFIER silent_mutation Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199 N N N N
vg1001190961 G -> DEL N N silent_mutation Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001190961 NA 1.32E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 5.74E-15 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 3.78E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 8.11E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.55E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 7.90E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.38E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.15E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.05E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 5.01E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 5.90E-17 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 2.64E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 9.31E-11 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 3.71E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 8.57E-06 8.38E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 4.03E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 2.49E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 2.98E-06 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.26E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 3.83E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 4.47E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.30E-09 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.58E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 8.52E-10 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 6.14E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 2.55E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 3.88E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.53E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.56E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 3.60E-14 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 6.29E-09 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 2.91E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 2.91E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.16E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 1.18E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 4.89E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 1.12E-07 NA mr1932 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 7.47E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 9.36E-09 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 NA 5.86E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 1.31E-08 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961 1.45E-06 6.66E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251