Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001190961:

Variant ID: vg1001190961 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1190961
Reference Allele: G	Alternative Allele: T,C
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATTCTCATCTACTACCTCCGTCCCAAAATAATTGCAATTCTATGTTATTTAGCATATATTAAGGTTTGAAAGAAAGACTACGGTGCCCCTCATTAAAT[G/T,C]
GTGTTTATGTGAGAGTGGGAAGATGGTTGAGGGTAAAATAGGGAGAAATTTGAATGAGATATGATTGATGGGGCAATTAGTACTCTAGAATTACAATTAT

Reverse complement sequence

ATAATTGTAATTCTAGAGTACTAATTGCCCCATCAATCATATCTCATTCAAATTTCTCCCTATTTTACCCTCAACCATCTTCCCACTCTCACATAAACAC[C/A,G]
ATTTAATGAGGGGCACCGTAGTCTTTCTTTCAAACCTTAATATATGCTAAATAACATAGAATTGCAATTATTTTGGGACGGAGGTAGTAGATGAGAATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.00%	21.10%	0.25%	0.70%	C: 0.04%
All Indica	2759	97.40%	1.70%	0.14%	0.69%	NA
All Japonica	1512	44.10%	55.40%	0.40%	0.13%	NA
Aus	269	97.40%	0.70%	0.00%	1.86%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	97.70%	0.40%	0.00%	1.86%	NA
Indica Intermediate	786	95.40%	3.80%	0.51%	0.25%	NA
Temperate Japonica	767	70.30%	29.60%	0.13%	0.00%	NA
Tropical Japonica	504	18.80%	80.80%	0.40%	0.00%	NA
Japonica Intermediate	241	13.70%	84.20%	1.24%	0.83%	NA
VI/Aromatic	96	9.40%	83.30%	0.00%	7.29%	NA
Intermediate	90	64.40%	31.10%	2.22%	0.00%	C: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001190961	G -> C	LOC_Os10g02910.1	upstream_gene_variant ; 1862.0bp to feature; MODIFIER	silent_mutation	Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199	N	N	N	N
vg1001190961	G -> C	LOC_Os10g02930.1	downstream_gene_variant ; 2272.0bp to feature; MODIFIER	silent_mutation	Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199	N	N	N	N
vg1001190961	G -> C	LOC_Os10g02930.2	downstream_gene_variant ; 1838.0bp to feature; MODIFIER	silent_mutation	Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199	N	N	N	N
vg1001190961	G -> C	LOC_Os10g02920.1	intron_variant ; MODIFIER	silent_mutation	Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199	N	N	N	N
vg1001190961	G -> T	LOC_Os10g02910.1	upstream_gene_variant ; 1862.0bp to feature; MODIFIER	silent_mutation	Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199	N	N	N	N
vg1001190961	G -> T	LOC_Os10g02930.1	downstream_gene_variant ; 2272.0bp to feature; MODIFIER	silent_mutation	Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199	N	N	N	N
vg1001190961	G -> T	LOC_Os10g02930.2	downstream_gene_variant ; 1838.0bp to feature; MODIFIER	silent_mutation	Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199	N	N	N	N
vg1001190961	G -> T	LOC_Os10g02920.1	intron_variant ; MODIFIER	silent_mutation	Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199	N	N	N	N
vg1001190961	G -> DEL	N	N	silent_mutation	Average:75.227; most accessible tissue: Minghui63 flower, score: 86.199	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001190961	NA	1.32E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	5.74E-15	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	3.78E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	8.11E-08	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.55E-07	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	7.90E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.38E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.15E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.05E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	5.01E-06	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	5.90E-17	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	2.64E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	9.31E-11	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	3.71E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	8.57E-06	8.38E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	4.03E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	2.49E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	2.98E-06	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.26E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	3.83E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	4.47E-07	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.30E-09	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.58E-13	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	8.52E-10	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	6.14E-08	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	2.55E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	3.88E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.53E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.56E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	3.60E-14	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	6.29E-09	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	2.91E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	2.91E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.16E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	1.18E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	4.89E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	1.12E-07	NA	mr1932	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	7.47E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	9.36E-09	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	NA	5.86E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	1.31E-08	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001190961	1.45E-06	6.66E-12	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251