\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001111430:

Variant ID: vg1001111430 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1111430
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGCCAACCGATCGGGCGCCATCATCAGAGGCGTCGGAGGCGCGAGTTGGACCTCACCTTGTGAGATGAAGGTGCACCTGCGCCTGTTTATAGTGAGTGT[C/T]
GTCGTCATCTTTTAATCCCTTTCATTTGGCAAGTTTAATCTGTGATTGAGAGGTTTGGAAGTTTGTTTCTTCGAGAAATTTGGGACTTTTGGTCAGTGGC

Reverse complement sequence

GCCACTGACCAAAAGTCCCAAATTTCTCGAAGAAACAAACTTCCAAACCTCTCAATCACAGATTAAACTTGCCAAATGAAAGGGATTAAAAGATGACGAC[G/A]
ACACTCACTATAAACAGGCGCAGGTGCACCTTCATCTCACAAGGTGAGGTCCAACTCGCGCCTCCGACGCCTCTGATGATGGCGCCCGATCGGTTGGCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 23.40% 0.08% 0.00% NA
All Indica  2759 93.90% 6.10% 0.00% 0.00% NA
All Japonica  1512 45.20% 54.60% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 87.90% 12.10% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 93.90% 6.10% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 68.60% 31.30% 0.13% 0.00% NA
Tropical Japonica  504 19.00% 80.80% 0.20% 0.00% NA
Japonica Intermediate  241 25.70% 74.30% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 67.80% 30.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001111430 C -> T LOC_Os10g02790.1 upstream_gene_variant ; 3427.0bp to feature; MODIFIER silent_mutation Average:58.383; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1001111430 C -> T LOC_Os10g02780.1 downstream_gene_variant ; 1464.0bp to feature; MODIFIER silent_mutation Average:58.383; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1001111430 C -> T LOC_Os10g02780-LOC_Os10g02790 intergenic_region ; MODIFIER silent_mutation Average:58.383; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001111430 NA 5.83E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 2.09E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 4.75E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 3.63E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 3.71E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 4.51E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 4.24E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 7.18E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 4.04E-06 4.04E-06 mr1597 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 3.31E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 4.21E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 1.26E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 2.95E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 9.91E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001111430 NA 8.12E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251