Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1001052701:

Variant ID: vg1001052701 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1052701
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATTTTGATAATTATTCGTTACCGTATTCGTTTCGATTCGTATTCGGCTCCGTATCTGTATTCGATAATATTCGATTCCGTTTTCGTATCCGGGTTTCC[G/A]
ATTCCGATTTCGATTCCGAGAAAAAAATATGAAAACGAATATGATATAGCTAGTTTCCGACCGTATTCGATCCGTTTTCATCCCTATCTTGCACTCGTCG

Reverse complement sequence

CGACGAGTGCAAGATAGGGATGAAAACGGATCGAATACGGTCGGAAACTAGCTATATCATATTCGTTTTCATATTTTTTTCTCGGAATCGAAATCGGAAT[C/T]
GGAAACCCGGATACGAAAACGGAATCGAATATTATCGAATACAGATACGGAGCCGAATACGAATCGAAACGAATACGGTAACGAATAATTATCAAAATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.00%	2.20%	30.94%	48.92%	NA
All Indica	2759	9.00%	1.00%	27.65%	62.34%	NA
All Japonica	1512	36.50%	4.80%	36.11%	22.55%	NA
Aus	269	6.30%	0.00%	42.75%	50.93%	NA
Indica I	595	7.20%	1.50%	23.19%	68.07%	NA
Indica II	465	12.30%	0.60%	42.15%	44.95%	NA
Indica III	913	8.80%	0.10%	24.42%	66.70%	NA
Indica Intermediate	786	8.70%	1.90%	26.21%	63.23%	NA
Temperate Japonica	767	63.50%	0.70%	10.30%	25.55%	NA
Tropical Japonica	504	7.50%	12.10%	64.88%	15.48%	NA
Japonica Intermediate	241	11.20%	2.90%	58.09%	27.80%	NA
VI/Aromatic	96	5.20%	0.00%	11.46%	83.33%	NA
Intermediate	90	30.00%	2.20%	30.00%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001052701	G -> A	LOC_Os10g02670.1	upstream_gene_variant ; 2224.0bp to feature; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052701	G -> A	LOC_Os10g02680.1	upstream_gene_variant ; 980.0bp to feature; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052701	G -> A	LOC_Os10g02700.1	upstream_gene_variant ; 4767.0bp to feature; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052701	G -> A	LOC_Os10g02690.1	downstream_gene_variant ; 2128.0bp to feature; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052701	G -> A	LOC_Os10g02670-LOC_Os10g02680	intergenic_region ; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052701	G -> DEL	N	N	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001052701	8.59E-09	8.58E-09	mr1068	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052701	NA	8.04E-06	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052701	4.67E-07	1.97E-08	mr1090	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052701	2.45E-06	5.56E-07	mr1211	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052701	NA	9.52E-07	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052701	NA	1.21E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251