Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001052700:

Variant ID: vg1001052700 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1052700
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATATTTTGATAATTATTCGTTACCGTATTCGTTTCGATTCGTATTCGGCTCCGTATCTGTATTCGATAATATTCGATTCCGTTTTCGTATCCGGGTTTC[C/T]
GATTCCGATTTCGATTCCGAGAAAAAAATATGAAAACGAATATGATATAGCTAGTTTCCGACCGTATTCGATCCGTTTTCATCCCTATCTTGCACTCGTC

Reverse complement sequence

GACGAGTGCAAGATAGGGATGAAAACGGATCGAATACGGTCGGAAACTAGCTATATCATATTCGTTTTCATATTTTTTTCTCGGAATCGAAATCGGAATC[G/A]
GAAACCCGGATACGAAAACGGAATCGAATATTATCGAATACAGATACGGAGCCGAATACGAATCGAAACGAATACGGTAACGAATAATTATCAAAATATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.50%	0.90%	21.12%	54.53%	NA
All Indica	2759	11.50%	0.30%	21.24%	67.02%	NA
All Japonica	1512	47.50%	2.30%	17.13%	33.07%	NA
Aus	269	9.30%	0.00%	47.21%	43.49%	NA
Indica I	595	11.40%	0.00%	10.76%	77.82%	NA
Indica II	465	14.80%	0.40%	35.48%	49.25%	NA
Indica III	913	9.40%	0.10%	21.69%	68.78%	NA
Indica Intermediate	786	12.00%	0.50%	20.23%	67.30%	NA
Temperate Japonica	767	66.90%	1.70%	6.13%	25.29%	NA
Tropical Japonica	504	29.40%	2.20%	29.56%	38.89%	NA
Japonica Intermediate	241	23.70%	4.60%	26.14%	45.64%	NA
VI/Aromatic	96	10.40%	0.00%	12.50%	77.08%	NA
Intermediate	90	43.30%	0.00%	15.56%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001052700	C -> T	LOC_Os10g02670.1	upstream_gene_variant ; 2223.0bp to feature; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052700	C -> T	LOC_Os10g02680.1	upstream_gene_variant ; 981.0bp to feature; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052700	C -> T	LOC_Os10g02700.1	upstream_gene_variant ; 4768.0bp to feature; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052700	C -> T	LOC_Os10g02690.1	downstream_gene_variant ; 2129.0bp to feature; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052700	C -> T	LOC_Os10g02670-LOC_Os10g02680	intergenic_region ; MODIFIER	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N
vg1001052700	C -> DEL	N	N	silent_mutation	Average:19.254; most accessible tissue: Callus, score: 45.704	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001052700	NA	1.22E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700	1.80E-08	2.43E-09	mr1240	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700	NA	6.12E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700	NA	1.88E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700	NA	2.12E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001052700	NA	4.25E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251