Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001020612:

Variant ID: vg1001020612 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1020612
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

GCGTTTATGCCCCATATGCCTTTGAGTAAGTTTTAATATCCACTAAGAGTATATGCATATAATCACGGCTCGACTAACAATTTTGTTTGCAGCGACCATT[G/A]
GATACTCTTTCTTCTCTATCTAAAGTACAATGAAGTCATCGTCTTGGATTCTTTGACGAAGACAGCAAGACATATCAGGAATTTCTAAGAACTATCGACC

Reverse complement sequence

GGTCGATAGTTCTTAGAAATTCCTGATATGTCTTGCTGTCTTCGTCAAAGAATCCAAGACGATGACTTCATTGTACTTTAGATAGAGAAGAAAGAGTATC[C/T]
AATGGTCGCTGCAAACAAAATTGTTAGTCGAGCCGTGATTATATGCATATACTCTTAGTGGATATTAAAACTTACTCAAAGGCATATGGGGCATAAACGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	19.50%	0.13%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	47.70%	52.20%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	73.40%	26.50%	0.13%	0.00%	NA
Tropical Japonica	504	21.60%	78.20%	0.20%	0.00%	NA
Japonica Intermediate	241	20.30%	79.70%	0.00%	0.00%	NA
VI/Aromatic	96	14.60%	84.40%	1.04%	0.00%	NA
Intermediate	90	67.80%	28.90%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001020612	G -> A	LOC_Os10g02644.1	downstream_gene_variant ; 2835.0bp to feature; MODIFIER	silent_mutation	Average:49.839; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1001020612	G -> A	LOC_Os10g02640.1	intron_variant ; MODIFIER	silent_mutation	Average:49.839; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001020612	NA	3.42E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	1.29E-10	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	5.73E-07	1.81E-10	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	1.85E-09	NA	mr1310	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	7.43E-06	3.36E-11	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	1.58E-14	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	7.84E-11	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	2.02E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	3.47E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	3.57E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	1.37E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	6.10E-14	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	5.99E-21	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	1.35E-16	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	3.78E-09	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	2.68E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	1.33E-06	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	1.22E-13	NA	mr1926	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	9.72E-08	5.03E-14	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	5.77E-07	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	1.53E-10	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	4.57E-12	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	9.98E-06	NA	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001020612	NA	8.30E-09	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251